Field Goal Fred Bitcoin Game Dog - Mix of Border Collie, Poodle, Labrador BK, Corgi, Boxer, Schnauzer and Maltese

Achievements

Racer
Field Goal Fred
It's a barkin' beautiful day! Field Goal Fred here. When I can get it, my favorite meal is pepperoni pizza and Milk-Bones. I'm always up for some puppy action, is that wrong? I like it when you're frisky. Peanut butter is delish but I HATE when it sticks to the roof of my mouth. Fun-loving and playful only need apply.
  • Purity 16%
  • Age 38 months
  • Racing Exp 1
  • Border Collie 45%
  • 1 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 0
 Best Time17.18 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GACTACTACGCATACAGCTACAACATATACACC
G
A
C
T
A
C
T
A
C
G
C
A
T
A
C
A
G
C
T
A
C
A
A
C
A
T
A
T
A
C
A
C
C
Genes: IJJ6JOJGCJK

Composition

Border Collie
45%
Poodle
9%
Labrador BK
9%
Corgi
9%
Boxer
9%
Schnauzer
9%
Maltese
9%

Current Energy

Vitality +2 points
Lunar Effect +4 points

Traits Breakdown

Body Poodle
Tail Border Collie
Legs Border Collie
Front Legs Labrador BK
Head Border Collie
Ears Corgi
Snout Border Collie
Mouth Boxer
Nose Schnauzer
Eyes Border Collie
Color Maltese

Parents

No Children

Photos