Mamie Mango Bitcoin Dog - Mix of Border Collie, Labrador, Husky, German Shepard and French Bulldog

Achievements

Racer
Mamie Mango
Even living on the internet like I do, too much kibble makes my bandwidth expand. I'll be honest...Napping is my favorite so we gotta go slow. I'm into leather...if I have the right partner. I'd like to find a dawg to hang with, no pressure. We can always make puppies later.
  • Purity 38%
  • Age 42 months
  • Racing Exp 1
  • Border Collie 64%
  • 1 races
  • Gen 9
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 0
 Best Time16.28 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACTACTACTACTACCCAACATACTCATACCGA
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
C
C
A
A
C
A
T
A
C
T
C
A
T
A
C
C
G
A
Genes: JJJJJ54J7J9

Composition

Border Collie
64%
Labrador
9%
Husky
9%
German Shepard
9%
French Bulldog
9%

Current Energy

Vitality +8 points
Lunar Effect 0 points

Traits Breakdown

Body Border Collie
Tail Border Collie
Legs Border Collie
Front Legs Border Collie
Head Border Collie
Ears Labrador
Snout Husky
Mouth Border Collie
Nose German Shepard
Eyes Border Collie
Color French Bulldog

Parents

No Children

Photos