Skip Simon Litecoin Game Dog - Mix of Border Collie, Grey Wolf, Labrador, Husky, German Shepard, Schnauzer and Rottweiler

Achievements

None
Skip Simon
Top o' the mornin' to ya! I'm Skip Simon. The Ethernet where I live, rocks. My favorite place in the world is the dog park. So many smells! Let me have a pig's ear and I'm in heaven. Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents.
  • Purity 18%
  • Age 40 months
  • Racing Exp 0
  • Border Collie 45%
  • 0 races
  • Gen 8
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACTACCCCTACTACCCAACATACTCAATACAC
T
A
C
T
A
C
C
C
C
T
A
C
T
A
C
C
C
A
A
C
A
T
A
C
T
C
A
A
T
A
C
A
C
Genes: JJLJJ54J7CH

Composition

Border Collie
45%
Grey Wolf
9%
Labrador
9%
Husky
9%
German Shepard
9%
Schnauzer
9%
Rottweiler
9%

Current Energy

Vitality +1 points
Lunar Effect 0 points

Traits Breakdown

Body Border Collie
Tail Border Collie
Legs Grey Wolf
Front Legs Border Collie
Head Border Collie
Ears Labrador
Snout Husky
Mouth Border Collie
Nose German Shepard
Eyes Schnauzer
Color Rottweiler