Jago Jagger Litecoin Dog - Mix of Shiba Inu, Rottweiler and French Bulldog

Achievements

Racer
Jago Jagger
How goes it? I'm Jago Jagger. You can access my database anytime with your WiFi. As a perfectionist, I have to find just the right 'spot'. Dragging my butt on the carpet feels so good. I like to smell everything, but my favorite smell is freshly cut grass. I like to roll in it until my fur turns green! I'm just looking for some puppy love.
  • Purity 65%
  • Age 40 months
  • Racing Exp 9
  • Shiba Inu 82%
  • 3 races
  • Gen 8
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 1 0
3 races    Best Time15.28 sec
No rank  Racing *** Coins
33.3 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTAGTAGTACACGTAGTAGTAGTACGAGTAGTA
G
T
A
G
T
A
G
T
A
C
A
C
G
T
A
G
T
A
G
T
A
G
T
A
C
G
A
G
T
A
G
T
A
Genes: EEEHEEEE9EE

Composition

Shiba Inu
82%
Rottweiler
9%
French Bulldog
9%

Current Energy

Vitality -22 points
Lunar Effect +24 points

Traits Breakdown

Body Shiba Inu
Tail Shiba Inu
Legs Shiba Inu
Front Legs Rottweiler
Head Shiba Inu
Ears Shiba Inu
Snout Shiba Inu
Mouth Shiba Inu
Nose French Bulldog
Eyes Shiba Inu
Color Shiba Inu

Parents

No Children

Photos

online canine race