Side Zone Shorty Digital Cryptocurrency Dog - Pure Shiba Inu

Achievements

First Pure Breed Dog
Racer
Podium Champion
Side Zone Shorty
I feel totally safe lying naked on a rug in front of a digital fire, surrounded by firewalls. I'm totally against baths! They are the worst! I absolutely love long walks when I can stop and smell the bushes. It's okay with me just to touch paws while we watch t.v. on the couch if you want to start slow.
  • Purity 100%
  • Age 41 months
  • Racing Exp 80
  • Shiba Inu 100%
  • 28 races
  • Gen 7
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 3 1 5
28 races    Best Time14.12 sec
No rank  Racing *** Coins
32.1 % wins (9) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTA
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
Genes: EEEEEEEEEEE

Composition

Shiba Inu
100%

Current Energy

Vitality -33 points
Lunar Effect 0 points

Traits Breakdown

Traits 100% Purebred Shiba Inu