Bailey Bork Litecoin Dog - Mix of Husky, Pitbull terrier, Shiba Inu, Poodle, Golder Retriever, French Bulldog, Boxer and Border Collie

Achievements

Racer
Podium Champion
Bailey Bork
Size matters. This dawg's into big databases. Long or short hair works for me, just no baldies please. I really enjoy heavy petting. The place I like most in the world is curled up in my human's bed, hogging all the covers! My humans say I bark too much, but I have a lot to say!
  • Purity 4%
  • Age 38 months
  • Racing Exp 31
  • Husky 18%
  • 7 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

7 races   |
  • 1 2 1
 Best Time14.77 sec
No rank  Racing *** Pts
57.1 % wins (4) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACAGACACAAGATCCGTATCCGTACGAAACTAC
A
C
A
G
A
C
A
C
A
A
G
A
T
C
C
G
T
A
T
C
C
G
T
A
C
G
A
A
A
C
T
A
C
Genes: 4I48NENE9GJ

Composition

Husky
18%
Pitbull terrier
18%
Shiba Inu
18%
Poodle
9%
Golder Retriever
9%
French Bulldog
9%
Boxer
9%
Border Collie
9%

Current Energy

Vitality -17 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail Poodle
Legs Husky
Front Legs Golder Retriever
Head Pitbull terrier
Ears Shiba Inu
Snout Pitbull terrier
Mouth Shiba Inu
Nose French Bulldog
Eyes Boxer
Color Border Collie