Fullback Flea Flicker Bitcoin Dog - Mix of Shiba Inu, Golder Retriever and German Shepard

Achievements

Podium Champion
Pro Racer
Master Champion
Fullback Flea Flicker
Sup? ;-) I'm Fullback Flea Flicker. I was born in the web cloud. I believe running along the beach to catch a stick can be nearly orgasmic. I would like to find someone that really appreciates the finer things in life: stinky socks, old tennis balls, toilet water, etc...
  • Purity 65%
  • Age 23 months
  • Racing Exp 139
  • Shiba Inu 82%
  • 28 races
  • Gen 10
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

28 races   |
  • 6 9 3
 Best Time14.65 sec
No rank  Racing *** Coins
64.3 % wins (18) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGAGTAGTATCAGTAGTAGTAGTAGTAGTAGTA
A
G
A
G
T
A
G
T
A
T
C
A
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
Genes: 8EE7EEEEEEE

Composition

Shiba Inu
82%
Golder Retriever
9%
German Shepard
9%

Current Energy

Vitality -6 points
Lunar Effect +4 points

Traits Breakdown

Body Golder Retriever
Tail Shiba Inu
Legs Shiba Inu
Front Legs German Shepard
Head Shiba Inu
Ears Shiba Inu
Snout Shiba Inu
Mouth Shiba Inu
Nose Shiba Inu
Eyes Shiba Inu
Color Shiba Inu

Parents

No Children

Photos

Bitcoin dog racing online doggy race crypto dog race virtual dog racing virtual doggy race photo Bitcoin doggy race online dog race Litecoin canine racing photo