Fullback Flea Flicker Bitcoin Dog - Mix of Shiba Inu, Golder Retriever and German Shepard
Fullback Flea Flicker
  • Purity 65%
  • Age 14 months
  • Racing Exp 139
  • Shiba Inu 82%
  • Gold medal 6 Silver medal 9 Bronze medal 3
  • 28 races
  • Gen 10
Depressed & Snaillike

Achievements

Podium Champion
Pro Racer
Master Champion

Bio

Sup? ;-) I'm Fullback Flea Flicker. I was born in the web cloud. I believe running along the beach to catch a stick can be nearly orgasmic. I would like to find someone that really appreciates the finer things in life: stinky socks, old tennis balls, toilet water, etc...

Racing Stats

Ran 28 races
  • 6 9 3
 Best Time14.65 sec
No rank  RacingĀ *** Pts
64.3 % wins (18) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: AGAGTAGTATCAGTAGTAGTAGTAGTAGTAGTA
A
G
A
G
T
A
G
T
A
T
C
A
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
Genes: 8EE7EEEEEEE

Composition

Shiba Inu
82%
Golder Retriever
9%
German Shepard
9%

Current Energy

Vitality -6 points
Lunar Effect -4 points

Traits Breakdown

Body Golder Retriever
Tail Shiba Inu
Legs Shiba Inu
Front Legs German Shepard
Head Shiba Inu
Ears Shiba Inu
Snout Shiba Inu
Mouth Shiba Inu
Nose Shiba Inu
Eyes Shiba Inu
Color Shiba Inu

Parents

No Children

Photos

crypto dog race results Litecoin pet race virtual doggy race cryptocurrency pet race podium online canine racing photo Litecoin dog racing results online canine race results virtual dog racing
Gift