Volvo Volkswagen Digital Cryptocurrency Dog - Mix of Shiba Inu, Golder Retriever, German Shepard, Beagle and Yorkshire Terrier
Volvo Volkswagen
  • Purity 38%
  • Age 14 months
  • Racing Exp 8
  • Shiba Inu 64%
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 3 races
  • Gen 9
Depressed & Snaillike

Achievements

Racer

Bio

Hello there, my name is Volvo Volkswagen. I get a little upset when my human gets mad at me for redecorating the house. It took me hours to spread all of that pillow stuffing out on the floor and I thought it looked perfect! I never knew my father. If you enjoy growling through fences as much as I do, we should get together.

Racing Stats

Ran 3 races
  • 0 0 1
 Best Time15.98 sec
No rank  RacingĀ *** Pts
33.3 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: AGAGTAGTATCAGTACTAGTAGTAGTAGTATTA
A
G
A
G
T
A
G
T
A
T
C
A
G
T
A
C
T
A
G
T
A
G
T
A
G
T
A
G
T
A
T
T
A
Genes: 8EE7EDEEEEF

Composition

Shiba Inu
64%
Golder Retriever
9%
German Shepard
9%
Beagle
9%
Yorkshire Terrier
9%

Current Energy

Vitality -17 points
Lunar Effect 0 points

Traits Breakdown

Body Golder Retriever
Tail Shiba Inu
Legs Shiba Inu
Front Legs German Shepard
Head Shiba Inu
Ears Beagle
Snout Shiba Inu
Mouth Shiba Inu
Nose Shiba Inu
Eyes Shiba Inu
Color Yorkshire Terrier