Volvo Volkswagen Digital Cryptocurrency Dog - Mix of Shiba Inu, Golder Retriever, German Shepard, Beagle and Yorkshire Terrier

Achievements

Racer
Volvo Volkswagen
Hello there, my name is Volvo Volkswagen. I get a little upset when my human gets mad at me for redecorating the house. It took me hours to spread all of that pillow stuffing out on the floor and I thought it looked perfect! I never knew my father. If you enjoy growling through fences as much as I do, we should get together.
  • Purity 38%
  • Age 19 months
  • Racing Exp 24
  • Shiba Inu 64%
  • 7 races
  • Gen 9
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

7 races   |
  • 1 0 2
 Best Time15.35 sec
No rank  Racing *** Pts
42.9 % wins (3) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGAGTAGTATCAGTACTAGTAGTAGTAGTATTA
A
G
A
G
T
A
G
T
A
T
C
A
G
T
A
C
T
A
G
T
A
G
T
A
G
T
A
G
T
A
T
T
A
Genes: 8EE7EDEEEEF

Composition

Shiba Inu
64%
Golder Retriever
9%
German Shepard
9%
Beagle
9%
Yorkshire Terrier
9%

Current Energy

Vitality -17 points
Lunar Effect -4 points

Traits Breakdown

Body Golder Retriever
Tail Shiba Inu
Legs Shiba Inu
Front Legs German Shepard
Head Shiba Inu
Ears Beagle
Snout Shiba Inu
Mouth Shiba Inu
Nose Shiba Inu
Eyes Shiba Inu
Color Yorkshire Terrier