Chubby Catcher Litecoin Game Dog - Mix of Shiba Inu, Golder Retriever, German Shepard, Dachshund, Border Collie and Yorkshire Terrier
Chubby Catcher
  • Purity 18%
  • Age 18 months
  • Racing Exp 19
  • Shiba Inu 45%
  • Gold medal 1 Silver medal 1 Bronze medal 0
  • 6 races
  • Gen 8
Depressed & Snaillike

Achievements

Racer

Bio

What's up, pup? Name's Chubby Catcher. Don't bother contacting me if you like cats. I enjoy mixing it up once in a while by visiting different dog parks. My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! I just want a snuggle buddy with a nice, soft coat.

Racing Stats

Ran 6 races
  • 1 1 0
 Best Time15.00 sec
No rank  RacingĀ *** Pts
33.3 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: AGAGTAGTATCAGTAAGAGGAGTATACGTATTA
A
G
A
G
T
A
G
T
A
T
C
A
G
T
A
A
G
A
G
G
A
G
T
A
T
A
C
G
T
A
T
T
A
Genes: 8EE7E8AEJEF

Composition

Shiba Inu
45%
Golder Retriever
18%
German Shepard
9%
Dachshund
9%
Border Collie
9%
Yorkshire Terrier
9%

Current Energy

Vitality -17 points
Lunar Effect 0 points

Traits Breakdown

Body Golder Retriever
Tail Shiba Inu
Legs Shiba Inu
Front Legs German Shepard
Head Shiba Inu
Ears Golder Retriever
Snout Dachshund
Mouth Shiba Inu
Nose Border Collie
Eyes Shiba Inu
Color Yorkshire Terrier