Miss Priss Marshall Litecoin Dog - Mix of Golder Retriever, Shiba Inu, Grey Wolf, German Shepard, French Bulldog, Dachshund, Border Collie, St. Bernard and Yorkshire Terrier
Miss Priss Marshall
  • Purity 3%
  • Age 14 months
  • Racing Exp 3
  • Golder Retriever 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 3 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

Hi, Miss Priss Marshall is my name. I live behind a firewall in the Machine. I believe running along the beach to catch a stick can be nearly orgasmic. I really enjoy squeaky toys! Well, I like ripping them apart and taking out the squeaker! I love it when you show a little teeth.

Racing Stats

Ran 3 races
  • 0 0 0
 Best Time16.38 sec
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: AGACCCGTATCACGAAGAGGAGTATACTGATTA
A
G
A
C
C
C
G
T
A
T
C
A
C
G
A
A
G
A
G
G
A
G
T
A
T
A
C
T
G
A
T
T
A
Genes: 8LE798AEJBF

Composition

Golder Retriever
18%
Shiba Inu
18%
Grey Wolf
9%
German Shepard
9%
French Bulldog
9%
Dachshund
9%
Border Collie
9%
St. Bernard
9%
Yorkshire Terrier
9%

Current Energy

Vitality -24 points
Lunar Effect -4 points

Traits Breakdown

Body Golder Retriever
Tail Grey Wolf
Legs Shiba Inu
Front Legs German Shepard
Head French Bulldog
Ears Golder Retriever
Snout Dachshund
Mouth Shiba Inu
Nose Border Collie
Eyes St. Bernard
Color Yorkshire Terrier