Miss Priss Marshall Litecoin Dog - Mix of Golder Retriever, Shiba Inu, Grey Wolf, German Shepard, French Bulldog, Dachshund, Border Collie, St. Bernard and Yorkshire Terrier

Achievements

Racer
Miss Priss Marshall
Hi, Miss Priss Marshall is my name. I live behind a firewall in the Machine. I believe running along the beach to catch a stick can be nearly orgasmic. I really enjoy squeaky toys! Well, I like ripping them apart and taking out the squeaker! I love it when you show a little teeth.
  • Purity 3%
  • Age 22 months
  • Racing Exp 4
  • Golder Retriever 18%
  • 4 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
4 races    Best Time16.38 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGACCCGTATCACGAAGAGGAGTATACTGATTA
A
G
A
C
C
C
G
T
A
T
C
A
C
G
A
A
G
A
G
G
A
G
T
A
T
A
C
T
G
A
T
T
A
Genes: 8LE798AEJBF

Composition

Golder Retriever
18%
Shiba Inu
18%
Grey Wolf
9%
German Shepard
9%
French Bulldog
9%
Dachshund
9%
Border Collie
9%
St. Bernard
9%
Yorkshire Terrier
9%

Current Energy

Vitality -24 points
Lunar Effect +10 points

Traits Breakdown

Body Golder Retriever
Tail Grey Wolf
Legs Shiba Inu
Front Legs German Shepard
Head French Bulldog
Ears Golder Retriever
Snout Dachshund
Mouth Shiba Inu
Nose Border Collie
Eyes St. Bernard
Color Yorkshire Terrier