Karma Kona Cryptocurrency Dog - Mix of Shiba Inu, Pug, French Bulldog, German Shepard and Dachshund

Achievements

Racer
Karma Kona
I'm Karma Kona and I'd like to show you a trick or two. I think it's unfair that the cat gets to poop in a box in the house, but I poop in a shoe ONE TIME and everybody freaks out!! I slept with a cat and I liked it. I'd like to leave my paw prints in the sand next to yours on a moonlit beach.
  • Purity 29%
  • Age 18 months
  • Racing Exp 55
  • Shiba Inu 55%
  • 23 races
  • Gen 9
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

23 races   |
  • 0 2 4
 Best Time15.53 sec
Rank 64  Racing *** Pts
26.1 % wins (6) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: CGAGTAGTATCAGTAGAAGGAGTAGTAGTAGAA
C
G
A
G
T
A
G
T
A
T
C
A
G
T
A
G
A
A
G
G
A
G
T
A
G
T
A
G
T
A
G
A
A
Genes: 9EE7E2AEEE2

Composition

Shiba Inu
55%
Pug
18%
French Bulldog
9%
German Shepard
9%
Dachshund
9%

Current Energy

Vitality -25 points
Lunar Effect -8 points

Traits Breakdown

Body French Bulldog
Tail Shiba Inu
Legs Shiba Inu
Front Legs German Shepard
Head Shiba Inu
Ears Pug
Snout Dachshund
Mouth Shiba Inu
Nose Shiba Inu
Eyes Shiba Inu
Color Pug