Nibby-Nose Nick Crypto Dog - Mix of Pug, French Bulldog, Labrador, Grey Wolf, Poodle, Border Collie, Labrador BK, Husky, Shiba Inu and St. Bernard

Achievements

Pro Racer
Podium Champion
Master Champion
Nibby-Nose Nick
My 'G' spot is under my chin...scratch me there and I'll growl softly. I enjoy crunchy kibble and drinking from toilets. I absolutely love long walks when I can stop and smell the bushes. I don't like having to stay in the car when my people go inside.
  • Purity 1%
  • Age 39 months
  • Racing Exp 91
  • Pug 18%
  • 23 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

23 races   |
  • 5 3 3
 Best Time15.62 sec
No rank  Racing *** Pts
47.8 % wins (11) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CGACCACCCGACTACGAAGCAACAGTATGAGAA
C
G
A
C
C
A
C
C
C
G
A
C
T
A
C
G
A
A
G
C
A
A
C
A
G
T
A
T
G
A
G
A
A
Genes: 95LIJ264EB2

Composition

Pug
18%
French Bulldog
9%
Labrador
9%
Grey Wolf
9%
Poodle
9%
Border Collie
9%
Labrador BK
9%
Husky
9%
Shiba Inu
9%
St. Bernard
9%

Current Energy

Vitality -15 points
Lunar Effect -4 points

Traits Breakdown

Body French Bulldog
Tail Labrador
Legs Grey Wolf
Front Legs Poodle
Head Border Collie
Ears Pug
Snout Labrador BK
Mouth Husky
Nose Shiba Inu
Eyes St. Bernard
Color Pug

Parents

Children

Photos

cryptocurrency doggy race results crypto dog racing podium crypto dog racing Litecoin doggy racing Litecoin doggy race photo crypto pet racing results online doggy racing online pet race podium