Beaux Bowen Crypto Game Dog - Mix of Shiba Inu, Rottweiler, Pug, German Shepard, Border Collie and French Bulldog

Achievements

Racer
Beaux Bowen
Barkjour mi amor! I'm Beaux Bowen. Even living on the internet like I do, too much kibble makes my bandwidth expand. The place I like most in the world is curled up in my human's bed, hogging all the covers! I hate it when my humans fart and they blame me!
  • Purity 19%
  • Age 20 months
  • Racing Exp 7
  • Shiba Inu 36%
  • 2 races
  • Gen 10
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 1
2 races    Best Time16.10 sec
No rank  Racing *** Coins
50.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACCACGTATCATACGAAGAACGAGTAGTAGTA
C
A
C
C
A
C
G
T
A
T
C
A
T
A
C
G
A
A
G
A
A
C
G
A
G
T
A
G
T
A
G
T
A
Genes: HHE7J229EEE

Composition

Shiba Inu
36%
Rottweiler
18%
Pug
18%
German Shepard
9%
Border Collie
9%
French Bulldog
9%

Current Energy

Vitality -12 points
Lunar Effect -4 points

Traits Breakdown

Body Rottweiler
Tail Rottweiler
Legs Shiba Inu
Front Legs German Shepard
Head Border Collie
Ears Pug
Snout Pug
Mouth French Bulldog
Nose Shiba Inu
Eyes Shiba Inu
Color Shiba Inu