Beaux Bowen Crypto Game Dog - Mix of Shiba Inu, Rottweiler, Pug, German Shepard, Border Collie and French Bulldog
Beaux Bowen
  • Purity 19%
  • Age 17 months
  • Racing Exp 24
  • Shiba Inu 36%
  • Gold medal 1 Silver medal 0 Bronze medal 2
  • 7 races
  • Gen 10
Sad & Slothful

Achievements

Racer

Bio

Barkjour mi amor! I'm Beaux Bowen. Even living on the internet like I do, too much kibble makes my bandwidth expand. The place I like most in the world is curled up in my human's bed, hogging all the covers! I hate it when my humans fart and they blame me!

Racing Stats

Ran 7 races
  • 1 0 2
 Best Time16.10 sec
No rank  RacingĀ *** Pts
42.9 % wins (3) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CACCACGTATCATACGAAGAACGAGTAGTAGTA
C
A
C
C
A
C
G
T
A
T
C
A
T
A
C
G
A
A
G
A
A
C
G
A
G
T
A
G
T
A
G
T
A
Genes: HHE7J229EEE

Composition

Shiba Inu
36%
Rottweiler
18%
Pug
18%
German Shepard
9%
Border Collie
9%
French Bulldog
9%

Current Energy

Vitality -12 points
Lunar Effect 0 points

Traits Breakdown

Body Rottweiler
Tail Rottweiler
Legs Shiba Inu
Front Legs German Shepard
Head Border Collie
Ears Pug
Snout Pug
Mouth French Bulldog
Nose Shiba Inu
Eyes Shiba Inu
Color Shiba Inu

Parents

No Children

Photos

crypto pet racing crypto dog racing podium cryptocurrency doggy race
Gift