Candy Clicker Litecoin Dog - Mix of Rottweiler, Pitbull terrier, Golder Retriever, Labrador BK, Border Collie, St. Bernard, Pug, French Bulldog and Shiba Inu
Candy Clicker
  • Purity 7%
  • Age 17 months
  • Racing Exp 34
  • Rottweiler 18%
  • Gold medal 2 Silver medal 1 Bronze medal 1
  • 9 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer
Speed Champion
Podium Champion

Bio

You can call me Candy Clicker, everybody else does. I'm willing to try little bondage, so my human chained me up! I hate it when other dogs pee in my yard! IT'S MY YARD!! In my humble opinion the best toy is one of my human's stinky, old socks. I'm on the lookout for someone willing to stop and smell the catpoop with me.

Racing Stats

Ran 9 races
  • 2 1 1
 Best Time13.72 sec
No rank  RacingĀ *** Pts
44.4 % wins (4) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CACCACAGAGCATACTGAGAACGATCCTCCGTA
C
A
C
C
A
C
A
G
A
G
C
A
T
A
C
T
G
A
G
A
A
C
G
A
T
C
C
T
C
C
G
T
A
Genes: HH86JB29NNE

Composition

Rottweiler
18%
Pitbull terrier
18%
Golder Retriever
9%
Labrador BK
9%
Border Collie
9%
St. Bernard
9%
Pug
9%
French Bulldog
9%
Shiba Inu
9%

Current Energy

Vitality -5 points
Lunar Effect +4 points

Traits Breakdown

Body Rottweiler
Tail Rottweiler
Legs Golder Retriever
Front Legs Labrador BK
Head Border Collie
Ears St. Bernard
Snout Pug
Mouth French Bulldog
Nose Pitbull terrier
Eyes Pitbull terrier
Color Shiba Inu