Ender Eddy Bitcoin Dog - Mix of Shiba Inu, Husky, Beagle, Golder Retriever, Pitbull terrier, Yorkshire Terrier and Rottweiler

Achievements

Racer
Ender Eddy
It's a barkin' beautiful day! Ender Eddy here. The cloud's my neighborhood. I love unconditionally. My turn-offs are rolled up newspapers and loud noises. I've always had a crush on Lassie. My favorite movie is Dog Day Afternoon. I've never seen it but I like the title!
  • Purity 14%
  • Age 41 months
  • Racing Exp 7
  • Shiba Inu 36%
  • 2 races
  • Gen 8
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 1
2 races    Best Time15.72 sec
No rank  Racing *** Coins
50.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTAAGAACAGTAGTAGTAACATCCTTAGTACAC
C
T
A
A
G
A
A
C
A
G
T
A
G
T
A
G
T
A
A
C
A
T
C
C
T
T
A
G
T
A
C
A
C
Genes: D84EEE4NFEH

Composition

Shiba Inu
36%
Husky
18%
Beagle
9%
Golder Retriever
9%
Pitbull terrier
9%
Yorkshire Terrier
9%
Rottweiler
9%

Current Energy

Vitality -28 points
Lunar Effect -4 points

Traits Breakdown

Body Beagle
Tail Golder Retriever
Legs Husky
Front Legs Shiba Inu
Head Shiba Inu
Ears Shiba Inu
Snout Husky
Mouth Pitbull terrier
Nose Yorkshire Terrier
Eyes Shiba Inu
Color Rottweiler

Parents

No Children

Photos

cryptocurrency canine racing