Brittany Buzz Crypto Dog - Mix of Border Collie, Schnauzer, French Bulldog, Beagle, Labrador, Corgi, Pitbull terrier and Dachshund

Achievements

Racer
Brittany Buzz
My favorite sport is catching treats my human throws! I like nibbling on most everything, but I'll bite if you want me to. I hate bubble baths; mud puddles are more my style. Those flying monkeys in the Wizard of Oz still scare me! I'm looking for someone who is also playful, feisty and happy.
  • Purity 6%
  • Age 41 months
  • Racing Exp 1
  • Border Collie 18%
  • 1 races
  • Gen 2
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
1 races    Best Time15.77 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTATACATAATACGACCAAGCTCCGGATACCGA
C
T
A
T
A
C
A
T
A
A
T
A
C
G
A
C
C
A
A
G
C
T
C
C
G
G
A
T
A
C
C
G
A
Genes: DJCC95ONAJ9

Composition

Border Collie
18%
Schnauzer
18%
French Bulldog
18%
Beagle
9%
Labrador
9%
Corgi
9%
Pitbull terrier
9%
Dachshund
9%

Current Energy

Vitality -55 points
Lunar Effect 0 points

Traits Breakdown

Body Beagle
Tail Border Collie
Legs Schnauzer
Front Legs Schnauzer
Head French Bulldog
Ears Labrador
Snout Corgi
Mouth Pitbull terrier
Nose Dachshund
Eyes Border Collie
Color French Bulldog