Buster Buddie Digital Cryptocurrency Dog - Mix of Schnauzer, Dachshund, Pug, Boxer, Labrador BK, Labrador, Corgi, Pitbull terrier and Husky

Achievements

Racer
Buster Buddie
They call me Buster Buddie. What's your name? Removing excess stuffing from pillows is my favorite hobby. My bark alone scares birds out of my yard. I wish my human wouldn't get mad at me for going through the trash. They were obviously finished with it, why can't I have it?! Just looking to sow some wild oats here...
  • Purity 5%
  • Age 41 months
  • Racing Exp 1
  • Schnauzer 18%
  • 1 races
  • Gen 1
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
1 races    Best Time16.25 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAAACATAATAGCACCAAGCTCCGGAACAGGA
G
A
A
A
A
C
A
T
A
A
T
A
G
C
A
C
C
A
A
G
C
T
C
C
G
G
A
A
C
A
G
G
A
Genes: 2GCC65ONA4A

Composition

Schnauzer
18%
Dachshund
18%
Pug
9%
Boxer
9%
Labrador BK
9%
Labrador
9%
Corgi
9%
Pitbull terrier
9%
Husky
9%

Current Energy

Vitality -65 points
Lunar Effect -4 points

Traits Breakdown

Body Pug
Tail Boxer
Legs Schnauzer
Front Legs Schnauzer
Head Labrador BK
Ears Labrador
Snout Corgi
Mouth Pitbull terrier
Nose Dachshund
Eyes Husky
Color Dachshund