Jabba Jenny Bitcoin Dog - Mix of French Bulldog, Boxer, Corgi and St. Bernard

Achievements

Racer
Jabba Jenny
They call me Jabba Jenny. What's your name? I'm 100% digital, baby. My bark alone scares birds out of my yard. Long or short hair works for me, just no baldies please. My favorite game is Fetch except I never bring the ball back. I'll outrun you for the ball if I can...that's just how I roll.
  • Purity 41%
  • Age 40 months
  • Racing Exp 1
  • French Bulldog 64%
  • 1 races
  • Gen 7
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
1 races    Best Time16.18 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CGACGACGACGACGAAACAGCAACCGATGACGA
C
G
A
C
G
A
C
G
A
C
G
A
C
G
A
A
A
C
A
G
C
A
A
C
C
G
A
T
G
A
C
G
A
Genes: 99999GOG9B9

Composition

French Bulldog
64%
Boxer
18%
Corgi
9%
St. Bernard
9%

Current Energy

Vitality -42 points
Lunar Effect -12 points

Traits Breakdown

Body French Bulldog
Tail French Bulldog
Legs French Bulldog
Front Legs French Bulldog
Head French Bulldog
Ears Boxer
Snout Corgi
Mouth Boxer
Nose French Bulldog
Eyes St. Bernard
Color French Bulldog