Hooch Helmet Crypto Dog - Mix of French Bulldog, Pug, Corgi, Boxer and St. Bernard

Achievements

None
Hooch Helmet
Hey there! Baby, call me Hooch Helmet. Too much steak gives me the runs! When I can get it, my favorite meal is pepperoni pizza and Milk-Bones. Blue toilet water turns me off. I really enjoy squeaky toys! Well, I like ripping them apart and taking out the squeaker! New experiences? New treats? New places! Yes, please!
  • Purity 40%
  • Age 42 months
  • Racing Exp 0
  • French Bulldog 64%
  • 0 races
  • Gen 8
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CGACGACGACGACGAGAAAGCAACCGATGACGA
C
G
A
C
G
A
C
G
A
C
G
A
C
G
A
G
A
A
A
G
C
A
A
C
C
G
A
T
G
A
C
G
A
Genes: 999992OG9B9

Composition

French Bulldog
64%
Pug
9%
Corgi
9%
Boxer
9%
St. Bernard
9%

Current Energy

Vitality -42 points
Lunar Effect +16 points

Traits Breakdown

Body French Bulldog
Tail French Bulldog
Legs French Bulldog
Front Legs French Bulldog
Head French Bulldog
Ears Pug
Snout Corgi
Mouth Boxer
Nose French Bulldog
Eyes St. Bernard
Color French Bulldog