Whispy Wesley Litecoin Game Dog - Mix of French Bulldog, Pug, Corgi, Boxer and Maltese

Achievements

Racer
Whispy Wesley
As a good digital dog, my humans give me virtually everything. I don't like thunder. I usually manage to scare it away with my vicious barks, but it always comes back again! Removing excess stuffing from pillows is my favorite hobby. Of course, I'm micro-chipped. I'm up on all the latest tech gadgets.
  • Purity 40%
  • Age 38 months
  • Racing Exp 9
  • French Bulldog 64%
  • 4 races
  • Gen 6
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

4 races   |
  • 0 0 1
 Best Time14.35 sec
No rank  Racing *** Pts
25.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CGACGACGACGACGAGAAAGCAACCGAACCCGA
C
G
A
C
G
A
C
G
A
C
G
A
C
G
A
G
A
A
A
G
C
A
A
C
C
G
A
A
C
C
C
G
A
Genes: 999992OG9K9

Composition

French Bulldog
64%
Pug
9%
Corgi
9%
Boxer
9%
Maltese
9%

Current Energy

Vitality -47 points
Lunar Effect -12 points

Traits Breakdown

Body French Bulldog
Tail French Bulldog
Legs French Bulldog
Front Legs French Bulldog
Head French Bulldog
Ears Pug
Snout Corgi
Mouth Boxer
Nose French Bulldog
Eyes Maltese
Color French Bulldog