Jynx Jake Digital Cryptocurrency Dog - Mix of French Bulldog, Maltese, Corgi, Grey Wolf, Labrador BK, St. Bernard, German Shepard and Shiba Inu

Achievements

Racer
Jynx Jake
I'm having some new data architecture built for me, then I'd like to have you over to my place. I'll eat my vomit and yours too. I enjoy exploration and am game for anything doggy-style. I'm looking for someone smart enough to help me find the treat stash.
  • Purity 6%
  • Age 41 months
  • Racing Exp 7
  • French Bulldog 27%
  • 1 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 1 0
1 races    Best Time15.55 sec
No rank  Racing *** Coins
100.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGCCGACCCCGAACCGCATGATCAGTAACCCGA
A
G
C
C
G
A
C
C
C
C
G
A
A
C
C
G
C
A
T
G
A
T
C
A
G
T
A
A
C
C
C
G
A
Genes: O9L9K6B7EK9

Composition

French Bulldog
27%
Maltese
18%
Corgi
9%
Grey Wolf
9%
Labrador BK
9%
St. Bernard
9%
German Shepard
9%
Shiba Inu
9%

Current Energy

Vitality -32 points
Lunar Effect +4 points

Traits Breakdown

Body Corgi
Tail French Bulldog
Legs Grey Wolf
Front Legs French Bulldog
Head Maltese
Ears Labrador BK
Snout St. Bernard
Mouth German Shepard
Nose Shiba Inu
Eyes Maltese
Color French Bulldog