Porkchop Princess Crypto Dog - Mix of Corgi, French Bulldog, St. Bernard, Husky, Maltese, Dachshund and Golder Retriever

Achievements

None
Porkchop Princess
Hey! My name's Porkchop Princess! I work in The Virtual Machine. Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents. I'll be mostly faithful to you...if we can agree on a bootie-pass for that Taco Bell dog!
  • Purity 9%
  • Age 41 months
  • Racing Exp 0
  • Corgi 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGCACCCGACGAGGATGAAGCACAACATGAAGA
A
G
C
A
C
C
C
G
A
C
G
A
G
G
A
T
G
A
A
G
C
A
C
A
A
C
A
T
G
A
A
G
A
Genes: OK99ABO44B8

Composition

Corgi
18%
French Bulldog
18%
St. Bernard
18%
Husky
18%
Maltese
9%
Dachshund
9%
Golder Retriever
9%

Current Energy

Vitality -40 points
Lunar Effect -6 points

Traits Breakdown

Body Corgi
Tail Maltese
Legs French Bulldog
Front Legs French Bulldog
Head Dachshund
Ears St. Bernard
Snout Corgi
Mouth Husky
Nose Husky
Eyes St. Bernard
Color Golder Retriever