Macintosh Madeline Digital Cryptocurrency Game Dog - Mix of French Bulldog, Corgi, Golder Retriever, Shiba Inu, German Shepard and Border Collie

Achievements

None
Macintosh Madeline
How do you do? I'm Macintosh Madeline. I need laid otherwise I'm going to start agreeing with Grumpy Cat. I absolutely love long walks when I can stop and smell the bushes. I'm always up for a nice long walk around the neighborhood. I want to find a mate who enjoys dog parks as much as I do.
  • Purity 27%
  • Age 38 months
  • Racing Exp 0
  • French Bulldog 55%
  • 0 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGCCGACGACGAAGAGTACGATCATACCGACGA
A
G
C
C
G
A
C
G
A
C
G
A
A
G
A
G
T
A
C
G
A
T
C
A
T
A
C
C
G
A
C
G
A
Genes: O9998E97J99

Composition

French Bulldog
55%
Corgi
9%
Golder Retriever
9%
Shiba Inu
9%
German Shepard
9%
Border Collie
9%

Current Energy

Vitality -48 points
Lunar Effect -18 points

Traits Breakdown

Body Corgi
Tail French Bulldog
Legs French Bulldog
Front Legs French Bulldog
Head Golder Retriever
Ears Shiba Inu
Snout French Bulldog
Mouth German Shepard
Nose Border Collie
Eyes French Bulldog
Color French Bulldog

Parents

No Children