Kira Katniss Cryptocurrency Dog - Mix of Border Collie, Poodle, Boxer, Rottweiler, Labrador BK, German Shepard and Dachshund

Achievements

Racer
Podium Champion
Master Champion
Kira Katniss
I hate it when I am not the center of attention. Little Bow Wow is my favorite musician. I just assume he's a dog... The smell of fresh manure to roll in makes me wild. As a perfectionist, I have to find just the right 'spot'. I'm not that picky. Wanna mate?
  • Purity 18%
  • Age 38 months
  • Racing Exp 171
  • Border Collie 45%
  • 49 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

49 races   |
  • 8 6 6
 Best Time14.20 sec
No rank  Racing *** Pts
40.8 % wins (20) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TACTACGACTACAACTACCACGCATCAGGATAC
T
A
C
T
A
C
G
A
C
T
A
C
A
A
C
T
A
C
C
A
C
G
C
A
T
C
A
G
G
A
T
A
C
Genes: JJIJGJH67AJ

Composition

Border Collie
45%
Poodle
9%
Boxer
9%
Rottweiler
9%
Labrador BK
9%
German Shepard
9%
Dachshund
9%

Current Energy

Vitality -29 points
Lunar Effect +4 points

Traits Breakdown

Body Border Collie
Tail Border Collie
Legs Poodle
Front Legs Border Collie
Head Boxer
Ears Border Collie
Snout Rottweiler
Mouth Labrador BK
Nose German Shepard
Eyes Dachshund
Color Border Collie