Dot Damien Crypto Dog - Mix of Border Collie and Pitbull terrier
Dot Damien
  • Purity 82%
  • Age 16 months
  • Racing Exp 8
  • Border Collie 91%
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 3 races
  • Gen 5
Depressed & Snaillike

Achievements

Racer

Bio

Hey there... I'm Dot Damien. I enjoy chasing my tail around. I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary! My favorite dessert is licking the last of the ice cream from the carton. No chocolate, please.

Racing Stats

Ran 3 races
  • 0 0 1
 Best Time15.45 sec
Rank 49  RacingĀ *** Pts
33.3 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TACTACTACTACTACTACTACTACTACTACTCC
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
C
C
Genes: JJJJJJJJJJN

Composition

Border Collie
91%
Pitbull terrier
9%

Current Energy

Vitality +7 points
Lunar Effect -22 points

Traits Breakdown

Body Border Collie
Tail Border Collie
Legs Border Collie
Front Legs Border Collie
Head Border Collie
Ears Border Collie
Snout Border Collie
Mouth Border Collie
Nose Border Collie
Eyes Border Collie
Color Pitbull terrier

Parents

No Children

Photos

virtual canine race
Gift