Dot Damien Crypto Dog - Mix of Border Collie and Pitbull terrier

Achievements

Racer
Dot Damien
Hey there... I'm Dot Damien. I enjoy chasing my tail around. I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary! My favorite dessert is licking the last of the ice cream from the carton. No chocolate, please.
  • Purity 82%
  • Age 21 months
  • Racing Exp 20
  • Border Collie 91%
  • 9 races
  • Gen 5
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 1 1
9 races    Best Time15.45 sec
No rank  Racing *** Coins
22.2 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACTACTACTACTACTACTACTACTACTACTCC
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
C
C
Genes: JJJJJJJJJJN

Composition

Border Collie
91%
Pitbull terrier
9%

Current Energy

Vitality +7 points
Lunar Effect +22 points

Traits Breakdown

Body Border Collie
Tail Border Collie
Legs Border Collie
Front Legs Border Collie
Head Border Collie
Ears Border Collie
Snout Border Collie
Mouth Border Collie
Nose Border Collie
Eyes Border Collie
Color Pitbull terrier