Dot Damien Crypto Dog - Mix of Border Collie and Pitbull terrier

Achievements

Podium Champion
Pro Racer
Master Champion
Dot Damien
Hey there... I'm Dot Damien. I enjoy chasing my tail around. I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary! My favorite dessert is licking the last of the ice cream from the carton. No chocolate, please.
  • Purity 82%
  • Age 18 months
  • Racing Exp 80
  • Border Collie 91%
  • 17 races
  • Gen 5
Share it to make him Happy!
Neutral & Agile
Energy: ▂▃▅▆▇

Racing Stats

17 races   |
  • 6 1 3
 Best Time15.45 sec
No rank  Racing *** Pts
58.8 % wins (10) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TACTACTACTACTACTACTACTACTACTACTCC
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
C
C
Genes: JJJJJJJJJJN

Composition

Border Collie
91%
Pitbull terrier
9%

Current Energy

Vitality +7 points
Lunar Effect 0 points

Traits Breakdown

Body Border Collie
Tail Border Collie
Legs Border Collie
Front Legs Border Collie
Head Border Collie
Ears Border Collie
Snout Border Collie
Mouth Border Collie
Nose Border Collie
Eyes Border Collie
Color Pitbull terrier