Sven Sailor Crypto Game Dog - Mix of Labrador BK, Poodle, Pitbull terrier, Border Collie, German Shepard, Husky and Schnauzer

Achievements

Racer
Sven Sailor
I love cuddling up, doggy-style after a romantic evening. I'm a gourmand...my favorite dish is that dry food that makes it's own gravy! I don't like having to stay off the furniture. I'm into group dog piles, the more the better. I'm looking for someone to make bath time a little more bearable!
  • Purity 11%
  • Age 21 months
  • Racing Exp 3
  • Labrador BK 27%
  • 3 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
3 races    Best Time16.77 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCATACGCAGCAGACGACTCAACATCCATATCC
G
C
A
T
A
C
G
C
A
G
C
A
G
A
C
G
A
C
T
C
A
A
C
A
T
C
C
A
T
A
T
C
C
Genes: 6J66II74NCN

Composition

Labrador BK
27%
Poodle
18%
Pitbull terrier
18%
Border Collie
9%
German Shepard
9%
Husky
9%
Schnauzer
9%

Current Energy

Vitality -11 points
Lunar Effect -2 points

Traits Breakdown

Body Labrador BK
Tail Border Collie
Legs Labrador BK
Front Legs Labrador BK
Head Poodle
Ears Poodle
Snout German Shepard
Mouth Husky
Nose Pitbull terrier
Eyes Schnauzer
Color Pitbull terrier