Sven Sailor Crypto Game Dog - Mix of Labrador BK, Poodle, Pitbull terrier, Border Collie, German Shepard, Husky and Schnauzer
Sven Sailor
  • Purity 11%
  • Age 51 months
  • Racing Exp 29
  • Labrador BK 27%
  • Gold medal 2 Silver medal 0 Bronze medal 1
  • 10 races
  • Gen 0
Depressed & Snaillike

Achievements

Pro Racer

Bio

I love cuddling up, doggy-style after a romantic evening. I'm a gourmand...my favorite dish is that dry food that makes it's own gravy! I don't like having to stay off the furniture. I'm into group dog piles, the more the better. I'm looking for someone to make bath time a little more bearable!

Racing Stats

Ran 10 races
  • 2 0 1
 Best Time15.72 sec
Rank 69  RacingĀ *** Pts
30.0% wins (3) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GCATACGCAGCAGACGACTCAACATCCATATCC
G
C
A
T
A
C
G
C
A
G
C
A
G
A
C
G
A
C
T
C
A
A
C
A
T
C
C
A
T
A
T
C
C
Genes: 6J66II74NCN

Composition

Labrador BK
27%
Poodle
18%
Pitbull terrier
18%
Border Collie
9%
German Shepard
9%
Husky
9%
Schnauzer
9%

Current Energy

Vitality -11 points
Lunar Effect -14 points

Traits Breakdown

Body Labrador BK
Tail Border Collie
Legs Labrador BK
Front Legs Labrador BK
Head Poodle
Ears Poodle
Snout German Shepard
Mouth Husky
Nose Pitbull terrier
Eyes Schnauzer
Color Pitbull terrier