Sven Sailor Crypto Game Dog - Mix of Labrador BK, Poodle, Pitbull terrier, Border Collie, German Shepard, Husky and Schnauzer

Achievements

Pro Racer
Podium Champion
Sven Sailor
I love cuddling up, doggy-style after a romantic evening. I'm a gourmand...my favorite dish is that dry food that makes it's own gravy! I don't like having to stay off the furniture. I'm into group dog piles, the more the better. I'm looking for someone to make bath time a little more bearable!
  • Purity 11%
  • Age 18 months
  • Racing Exp 62
  • Labrador BK 27%
  • 20 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

20 races   |
  • 2 3 2
 Best Time15.63 sec
No rank  Racing *** Pts
35.0 % wins (7) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GCATACGCAGCAGACGACTCAACATCCATATCC
G
C
A
T
A
C
G
C
A
G
C
A
G
A
C
G
A
C
T
C
A
A
C
A
T
C
C
A
T
A
T
C
C
Genes: 6J66II74NCN

Composition

Labrador BK
27%
Poodle
18%
Pitbull terrier
18%
Border Collie
9%
German Shepard
9%
Husky
9%
Schnauzer
9%

Current Energy

Vitality -11 points
Lunar Effect +2 points

Traits Breakdown

Body Labrador BK
Tail Border Collie
Legs Labrador BK
Front Legs Labrador BK
Head Poodle
Ears Poodle
Snout German Shepard
Mouth Husky
Nose Pitbull terrier
Eyes Schnauzer
Color Pitbull terrier