Finnegan Frankie Cryptocurrency Dog - Mix of Labrador BK, Border Collie, Beagle, German Shepard, Husky, Pug and Pitbull terrier
Finnegan Frankie
  • Purity 9%
  • Age 51 months
  • Racing Exp 50
  • Labrador BK 27%
  • Gold medal 2 Silver medal 4 Bronze medal 0
  • 12 races
  • Gen 2
Depressed & Snaillike

Achievements

Pro Racer

Bio

Hi, I'm Finnegan Frankie. Once you go digital, baby, you never go back. I usually spend my days protecting my yard from those pesky squirrels. I don't know what it is, but I know they're up to no good... Hope you like the smell of wet fur, because I'll jump into any water I see!

Racing Stats

Ran 12 races
  • 2 4 0
 Best Time15.33 sec
Rank 34  RacingĀ *** Pts
50.0% wins (6) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GCATACGCAGCATACCTATCAACACTAGAATCC
G
C
A
T
A
C
G
C
A
G
C
A
T
A
C
C
T
A
T
C
A
A
C
A
C
T
A
G
A
A
T
C
C
Genes: 6J66JD74D2N

Composition

Labrador BK
27%
Border Collie
18%
Beagle
18%
German Shepard
9%
Husky
9%
Pug
9%
Pitbull terrier
9%

Current Energy

Vitality +4 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador BK
Tail Border Collie
Legs Labrador BK
Front Legs Labrador BK
Head Border Collie
Ears Beagle
Snout German Shepard
Mouth Husky
Nose Beagle
Eyes Pug
Color Pitbull terrier

Parents

No Children

Photos

Litecoin dog racing results virtual doggy race virtual canine racing results crypto dog racing photo online dog race online doggy race
Gift