Finnegan Frankie Cryptocurrency Dog - Mix of Labrador BK, Border Collie, Beagle, German Shepard, Husky, Pug and Pitbull terrier
Finnegan Frankie
  • Purity 9%
  • Age 16 months
  • Racing Exp 15
  • Labrador BK 27%
  • Gold medal 0 Silver medal 2 Bronze medal 0
  • 3 races
  • Gen 2
Depressed & Snaillike

Achievements

Racer

Bio

Hi, I'm Finnegan Frankie. Once you go digital, baby, you never go back. I usually spend my days protecting my yard from those pesky squirrels. I don't know what it is, but I know they're up to no good... Hope you like the smell of wet fur, because I'll jump into any water I see!

Racing Stats

Ran 3 races
  • 0 2 0
 Best Time15.33 sec
No rank  RacingĀ *** Pts
66.7 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GCATACGCAGCATACCTATCAACACTAGAATCC
G
C
A
T
A
C
G
C
A
G
C
A
T
A
C
C
T
A
T
C
A
A
C
A
C
T
A
G
A
A
T
C
C
Genes: 6J66JD74D2N

Composition

Labrador BK
27%
Border Collie
18%
Beagle
18%
German Shepard
9%
Husky
9%
Pug
9%
Pitbull terrier
9%

Current Energy

Vitality +4 points
Lunar Effect -12 points

Traits Breakdown

Body Labrador BK
Tail Border Collie
Legs Labrador BK
Front Legs Labrador BK
Head Border Collie
Ears Beagle
Snout German Shepard
Mouth Husky
Nose Beagle
Eyes Pug
Color Pitbull terrier

Parents

No Children

Photos

online dog racing online dog race
Gift