Finnegan Frankie Cryptocurrency Dog - Mix of Labrador BK, Border Collie, Beagle, German Shepard, Husky, Pug and Pitbull terrier

Achievements

Pro Racer
Podium Champion
Master Champion
Finnegan Frankie
Hi, I'm Finnegan Frankie. Once you go digital, baby, you never go back. I usually spend my days protecting my yard from those pesky squirrels. I don't know what it is, but I know they're up to no good... Hope you like the smell of wet fur, because I'll jump into any water I see!
  • Purity 9%
  • Age 18 months
  • Racing Exp 83
  • Labrador BK 27%
  • 23 races
  • Gen 2
Share it to make him Happy!
Neutral & Casual
Energy: ▂▃▅▆▇

Racing Stats

23 races   |
  • 3 4 3
 Best Time15.33 sec
No rank  Racing *** Pts
43.5 % wins (10) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GCATACGCAGCATACCTATCAACACTAGAATCC
G
C
A
T
A
C
G
C
A
G
C
A
T
A
C
C
T
A
T
C
A
A
C
A
C
T
A
G
A
A
T
C
C
Genes: 6J66JD74D2N

Composition

Labrador BK
27%
Border Collie
18%
Beagle
18%
German Shepard
9%
Husky
9%
Pug
9%
Pitbull terrier
9%

Current Energy

Vitality +4 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador BK
Tail Border Collie
Legs Labrador BK
Front Legs Labrador BK
Head Border Collie
Ears Beagle
Snout German Shepard
Mouth Husky
Nose Beagle
Eyes Pug
Color Pitbull terrier