Verona Victoria Crypto Dog - Mix of Pug, Labrador BK and Border Collie
Verona Victoria
  • Purity 46%
  • Age 17 months
  • Racing Exp 30
  • Pug 64%
  • Gold medal 1 Silver medal 0 Bronze medal 3
  • 8 races
  • Gen 3
Depressed & Snaillike

Achievements

Racer

Bio

How do you do? I'm Verona Victoria. Long or short hair works for me, just no baldies please. I enjoy chasing my tail around. My humans say I slobber too much, but hey, I'm just juicy. If you are looking for companionship without commitment, keep looking.

Racing Stats

Ran 8 races
  • 1 0 3
 Best Time16.08 sec
No rank  RacingĀ *** Pts
50.0 % wins (4) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GCAGAAGAAGCAGCATACGAAGAAGAAGAAGAA
G
C
A
G
A
A
G
A
A
G
C
A
G
C
A
T
A
C
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
Genes: 62266J22222

Composition

Pug
64%
Labrador BK
27%
Border Collie
9%

Current Energy

Vitality -36 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador BK
Tail Pug
Legs Pug
Front Legs Labrador BK
Head Labrador BK
Ears Border Collie
Snout Pug
Mouth Pug
Nose Pug
Eyes Pug
Color Pug

Parents

No Children

Photos

crypto dog race Litecoin doggy race Bitcoin dog racing results cryptocurrency pet racing podium
Gift