Verona Victoria Crypto Dog - Mix of Pug, Labrador BK and Border Collie

Achievements

Racer
Verona Victoria
How do you do? I'm Verona Victoria. Long or short hair works for me, just no baldies please. I enjoy chasing my tail around. My humans say I slobber too much, but hey, I'm just juicy. If you are looking for companionship without commitment, keep looking.
  • Purity 46%
  • Age 20 months
  • Racing Exp 14
  • Pug 64%
  • 4 races
  • Gen 3
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 2
4 races    Best Time16.08 sec
No rank  Racing *** Coins
50.0 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAGAAGAAGCAGCATACGAAGAAGAAGAAGAA
G
C
A
G
A
A
G
A
A
G
C
A
G
C
A
T
A
C
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
Genes: 62266J22222

Composition

Pug
64%
Labrador BK
27%
Border Collie
9%

Current Energy

Vitality -36 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador BK
Tail Pug
Legs Pug
Front Legs Labrador BK
Head Labrador BK
Ears Border Collie
Snout Pug
Mouth Pug
Nose Pug
Eyes Pug
Color Pug

Parents

No Children

Photos

online doggy race photo crypto canine racing Litecoin canine racing podium virtual dog race podium crypto pet race