Salty Solomon Litecoin Game Dog - Mix of Yorkshire Terrier, Labrador BK, Poodle, German Shepard, Pitbull terrier and Maltese

Achievements

Racer
Salty Solomon
Hello, there. Salty Solomon here. I run exclusively on code. Oh, go ahead. Pet me. I know you want to. I love unconditionally. I hate having to wear foo-foo clothes and ribbons in my fur. My favorite pastime is playing tug-of-war with my human's underwear.
  • Purity 18%
  • Age 18 months
  • Racing Exp 50
  • Yorkshire Terrier 45%
  • 17 races
  • Gen 1
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

17 races   |
  • 0 3 3
 Best Time15.20 sec
Rank 88  Racing *** Pts
35.3 % wins (6) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GCATTAGCATTATTAGACTCATTATCCACCTTA
G
C
A
T
T
A
G
C
A
T
T
A
T
T
A
G
A
C
T
C
A
T
T
A
T
C
C
A
C
C
T
T
A
Genes: 6F6FFI7FNKF

Composition

Yorkshire Terrier
45%
Labrador BK
18%
Poodle
9%
German Shepard
9%
Pitbull terrier
9%
Maltese
9%

Current Energy

Vitality -26 points
Lunar Effect +16 points

Traits Breakdown

Body Labrador BK
Tail Yorkshire Terrier
Legs Labrador BK
Front Legs Yorkshire Terrier
Head Yorkshire Terrier
Ears Poodle
Snout German Shepard
Mouth Yorkshire Terrier
Nose Pitbull terrier
Eyes Maltese
Color Yorkshire Terrier