Salty Solomon Litecoin Game Dog - Mix of Yorkshire Terrier, Labrador BK, Poodle, German Shepard, Pitbull terrier and Maltese
Salty Solomon
  • Purity 18%
  • Age 15 months
  • Racing Exp 8
  • Yorkshire Terrier 45%
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 3 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer

Bio

Hello, there. Salty Solomon here. I run exclusively on code. Oh, go ahead. Pet me. I know you want to. I love unconditionally. I hate having to wear foo-foo clothes and ribbons in my fur. My favorite pastime is playing tug-of-war with my human's underwear.

Racing Stats

Ran 3 races
  • 0 0 1
 Best Time16.13 sec
No rank  RacingĀ *** Pts
33.3 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GCATTAGCATTATTAGACTCATTATCCACCTTA
G
C
A
T
T
A
G
C
A
T
T
A
T
T
A
G
A
C
T
C
A
T
T
A
T
C
C
A
C
C
T
T
A
Genes: 6F6FFI7FNKF

Composition

Yorkshire Terrier
45%
Labrador BK
18%
Poodle
9%
German Shepard
9%
Pitbull terrier
9%
Maltese
9%

Current Energy

Vitality -26 points
Lunar Effect +16 points

Traits Breakdown

Body Labrador BK
Tail Yorkshire Terrier
Legs Labrador BK
Front Legs Yorkshire Terrier
Head Yorkshire Terrier
Ears Poodle
Snout German Shepard
Mouth Yorkshire Terrier
Nose Pitbull terrier
Eyes Maltese
Color Yorkshire Terrier

Parents

No Children

Photos

online doggy racing photo
Gift