Little-Rascal Libby Digital Cryptocurrency Dog - Mix of Border Collie, Corgi, Rottweiler, Labrador BK, French Bulldog, Grey Wolf, Pug and Husky

Achievements

None
Little-Rascal Libby
Hello, there. Little-Rascal Libby here. Taking a break from chasing Nyan Cat around cyberspace. I love cuddling up, doggy-style after a romantic evening. I adore sleeping upside down with my tongue hanging out! I hate being left alone all day. Eat, sleep, poop. Honey, I've got it made.
  • Purity 4%
  • Age 43 months
  • Racing Exp 0
  • Border Collie 18%
  • 0 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCATACAGCCGACACAGCTACCCCGAAACACAC
G
C
A
T
A
C
A
G
C
C
G
A
C
A
C
A
G
C
T
A
C
C
C
C
G
A
A
A
C
A
C
A
C
Genes: 6JO9HOJL24H

Composition

Border Collie
18%
Corgi
18%
Rottweiler
18%
Labrador BK
9%
French Bulldog
9%
Grey Wolf
9%
Pug
9%
Husky
9%

Current Energy

Vitality -23 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador BK
Tail Border Collie
Legs Corgi
Front Legs French Bulldog
Head Rottweiler
Ears Corgi
Snout Border Collie
Mouth Grey Wolf
Nose Pug
Eyes Husky
Color Rottweiler