June Joker Digital Cryptocurrency Dog - Mix of Border Collie, Corgi, Labrador BK and Schnauzer

Achievements

Racer
June Joker
Hey there... I'm June Joker. I don't like thunder. I usually manage to scare it away with my vicious barks, but it always comes back again! I enjoy going to the dog park to see all my friends! I'm looking for a poodle in the streets, and a bulldog in the sheets!
  • Purity 39%
  • Age 41 months
  • Racing Exp 14
  • Border Collie 64%
  • 2 races
  • Gen 10
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 1 0 1
2 races    Best Time14.65 sec
No rank  Racing *** Coins
100.0 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACTACAGCTACTACAGCTACTACGCAATATAC
T
A
C
T
A
C
A
G
C
T
A
C
T
A
C
A
G
C
T
A
C
T
A
C
G
C
A
A
T
A
T
A
C
Genes: JJOJJOJJ6CJ

Composition

Border Collie
64%
Corgi
18%
Labrador BK
9%
Schnauzer
9%

Current Energy

Vitality -14 points
Lunar Effect -6 points

Traits Breakdown

Body Border Collie
Tail Border Collie
Legs Corgi
Front Legs Border Collie
Head Border Collie
Ears Corgi
Snout Border Collie
Mouth Border Collie
Nose Labrador BK
Eyes Schnauzer
Color Border Collie