Dandy Detroit Crypto Game Dog - Mix of Yorkshire Terrier, Shiba Inu, Corgi, Maltese, Border Collie, Pug, Grey Wolf, Beagle and Pitbull terrier

Achievements

Racer
Podium Champion
Dandy Detroit
My AI may be artificial, but at least I'm intelligent. I've been known to run with bad dogs. I love cuddling up, doggy-style after a romantic evening. My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! New experiences? New treats? New places! Yes, please!
  • Purity 6%
  • Age 42 months
  • Racing Exp 30
  • Yorkshire Terrier 27%
  • 12 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 1 1 1
12 races    Best Time16.08 sec
No rank  Racing *** Coins
25.0 % wins (3) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TTAGTAAGCACCTTATACGAACCCCTATCCTTA
T
T
A
G
T
A
A
G
C
A
C
C
T
T
A
T
A
C
G
A
A
C
C
C
C
T
A
T
C
C
T
T
A
Genes: FEOKFJ2LDNF

Composition

Yorkshire Terrier
27%
Shiba Inu
9%
Corgi
9%
Maltese
9%
Border Collie
9%
Pug
9%
Grey Wolf
9%
Beagle
9%
Pitbull terrier
9%

Current Energy

Vitality -60 points
Lunar Effect 0 points

Traits Breakdown

Body Yorkshire Terrier
Tail Shiba Inu
Legs Corgi
Front Legs Maltese
Head Yorkshire Terrier
Ears Border Collie
Snout Pug
Mouth Grey Wolf
Nose Beagle
Eyes Pitbull terrier
Color Yorkshire Terrier