Brandy Brock Litecoin Dog - Mix of German Shepard, Shiba Inu, Labrador, Border Collie, Dachshund, Labrador BK and Husky
Brandy Brock
  • Purity 7%
  • Age 44 days
  • Racing Exp 0
  • German Shepard 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 1
Sad & Tardy

Achievements

None

Bio

How you doin? ;) Brandy Brock here. I'm not a bad dog, my data is just configured that way. After introductory sniffing, I like some licking. When my human brushes my coat, I get frisky! As a designer, I suggest low windows or couch backs next to windows without curtains.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TACGTATCACCATCACCATCAGGAGCAGTAACA
T
A
C
G
T
A
T
C
A
C
C
A
T
C
A
C
C
A
T
C
A
G
G
A
G
C
A
G
T
A
A
C
A
Genes: JE75757A6E4

Composition

German Shepard
27%
Shiba Inu
18%
Labrador
18%
Border Collie
9%
Dachshund
9%
Labrador BK
9%
Husky
9%

Current Energy

Vitality +44 points
Lunar Effect -4 points

Traits Breakdown

Body Border Collie
Tail Shiba Inu
Legs German Shepard
Front Legs Labrador
Head German Shepard
Ears Labrador
Snout German Shepard
Mouth Dachshund
Nose Labrador BK
Eyes Shiba Inu
Color Husky

Parents

No Children

Gift