Brandy Brock Litecoin Dog - Mix of German Shepard, Shiba Inu, Labrador, Border Collie, Dachshund, Labrador BK and Husky
Brandy Brock
  • Purity 7%
  • Age 40 months
  • Racing Exp 15
  • German Shepard 27%
  • Gold medal 0 Silver medal 1 Bronze medal 1
  • 4 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer

Bio

How you doin? ;) Brandy Brock here. I'm not a bad dog, my data is just configured that way. After introductory sniffing, I like some licking. When my human brushes my coat, I get frisky! As a designer, I suggest low windows or couch backs next to windows without curtains.

Racing Stats

Ran 4 races
  • 0 1 1
 Best Time16.88 sec
No rank  RacingĀ *** Pts
50.0% wins (2) Breeding *** Pts
Scheduled races 1 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TACGTATCACCATCACCATCAGGAGCAGTAACA
T
A
C
G
T
A
T
C
A
C
C
A
T
C
A
C
C
A
T
C
A
G
G
A
G
C
A
G
T
A
A
C
A
Genes: JE75757A6E4

Composition

German Shepard
27%
Shiba Inu
18%
Labrador
18%
Border Collie
9%
Dachshund
9%
Labrador BK
9%
Husky
9%

Current Energy

Vitality -2 points
Lunar Effect +4 points

Traits Breakdown

Body Border Collie
Tail Shiba Inu
Legs German Shepard
Front Legs Labrador
Head German Shepard
Ears Labrador
Snout German Shepard
Mouth Dachshund
Nose Labrador BK
Eyes Shiba Inu
Color Husky

Parents

No Children

Photos

virtual canine race results online dog race podium
Gift