Chip Carter Cryptocurrency Dog - Mix of German Shepard, Shiba Inu, Golder Retriever, Rottweiler, Labrador, Poodle, Labrador BK and St. Bernard

Achievements

Racer
Chip Carter
I'm totally against baths! They are the worst! If I had to pick a favorite food it would be a hot-dog, because you are what you eat! I enjoy trying to be friends with the neighbor's cats. They still run away from me but they'll grow to love me one day!
  • Purity 6%
  • Age 20 months
  • Racing Exp 10
  • German Shepard 27%
  • 3 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 1 0 0
3 races    Best Time14.68 sec
No rank  Racing *** Coins
33.3 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGAGTATCACACTCACCATCAGACGCAGTATGA
A
G
A
G
T
A
T
C
A
C
A
C
T
C
A
C
C
A
T
C
A
G
A
C
G
C
A
G
T
A
T
G
A
Genes: 8E7H757I6EB

Composition

German Shepard
27%
Shiba Inu
18%
Golder Retriever
9%
Rottweiler
9%
Labrador
9%
Poodle
9%
Labrador BK
9%
St. Bernard
9%

Current Energy

Vitality -7 points
Lunar Effect -4 points

Traits Breakdown

Body Golder Retriever
Tail Shiba Inu
Legs German Shepard
Front Legs Rottweiler
Head German Shepard
Ears Labrador
Snout German Shepard
Mouth Poodle
Nose Labrador BK
Eyes Shiba Inu
Color St. Bernard