Gordon Gibson Digital Cryptocurrency Game Dog - Mix of Pug, Boxer, Grey Wolf, Corgi, Labrador, French Bulldog, Shiba Inu, Beagle and Dachshund

Achievements

None
Gordon Gibson
Currently, I live on the information superhighway. Air Bud is definitely my favorite movie. What a role model! I hate the mailman! He's always trying to sneak up on me, but I've got my eye on him! If you are looking for companionship without commitment, keep looking.
  • Purity 3%
  • Age 33 days
  • Racing Exp 0
  • Pug 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCCAGCCCACGAGTAGAAAACCTAAACGGAGAA
C
C
C
A
G
C
C
C
A
C
G
A
G
T
A
G
A
A
A
A
C
C
T
A
A
A
C
G
G
A
G
A
A
Genes: LO59E2GDGA2

Composition

Pug
18%
Boxer
18%
Grey Wolf
9%
Corgi
9%
Labrador
9%
French Bulldog
9%
Shiba Inu
9%
Beagle
9%
Dachshund
9%

Current Energy

Vitality +41 points
Lunar Effect -12 points

Traits Breakdown

Body Grey Wolf
Tail Corgi
Legs Labrador
Front Legs French Bulldog
Head Shiba Inu
Ears Pug
Snout Boxer
Mouth Beagle
Nose Boxer
Eyes Dachshund
Color Pug

Parents

No Children