Speed Snuggles Bitcoin Dog - Mix of German Shepard and Pug
Speed Snuggles
  • Purity 82%
  • Age 21 days
  • Racing Exp 41
  • German Shepard 91%
  • Gold medal 4 Silver medal 1 Bronze medal 0
  • 7 races
  • Gen 20
Sad & Tardy

Achievements

Racer
TOP 10 Fastest

Bio

Speed Snuggles here, let's shake. I'm not a fan of sleeping on the floor. This body was made for cuddles! I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! I wish I could spend every weekend going camping with my human. All the animals out there smell so funny!

Racing Stats

Ran 7 races
  • 4 1 0
 Best Time14.62 sec
Rank 1  RacingĀ *** Pts
71.4 % wins (5) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TCAGAATCATCATCATCATCATCATCATCATCA
T
C
A
G
A
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
Genes: 72777777777

Composition

German Shepard
91%
Pug
9%

Current Energy

Vitality +48 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail Pug
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears German Shepard
Snout German Shepard
Mouth German Shepard
Nose German Shepard
Eyes German Shepard
Color German Shepard