Skye Sheba Bitcoin Dog - Mix of Dachshund, Husky, Beagle, Pug, Labrador, Maltese, Yorkshire Terrier, Grey Wolf and St. Bernard

Achievements

None
Skye Sheba
Skye Sheba here, let's shake. I'm not a fan of sleeping on the floor. This body was made for cuddles! I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! I wish I could spend every weekend going camping with my human. All the animals out there smell so funny!
  • Purity 3%
  • Age 3 months
  • Racing Exp 0
  • Dachshund 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTAGAACCAACCTTAGGAACAGGAACACCCTGA
C
T
A
G
A
A
C
C
A
A
C
C
T
T
A
G
G
A
A
C
A
G
G
A
A
C
A
C
C
C
T
G
A
Genes: D25KFA4A4LB

Composition

Dachshund
18%
Husky
18%
Beagle
9%
Pug
9%
Labrador
9%
Maltese
9%
Yorkshire Terrier
9%
Grey Wolf
9%
St. Bernard
9%

Current Energy

Vitality -39 points
Lunar Effect -2 points

Traits Breakdown

Body Beagle
Tail Pug
Legs Labrador
Front Legs Maltese
Head Yorkshire Terrier
Ears Dachshund
Snout Husky
Mouth Dachshund
Nose Husky
Eyes Grey Wolf
Color St. Bernard

Parents

No Children