Bits Brandi Litecoin Dog - Mix of Labrador, Golder Retriever, Maltese, Pitbull terrier, German Shepard, Husky, Grey Wolf, St. Bernard, Beagle, Boxer and Border Collie

Achievements

None
Bits Brandi
Currently, I live on the information superhighway. I love it when you show a little teeth. As a perfectionist, I have to find just the right 'spot'. My favorite chews are underwear and rawhide...the rawhide lasts longer. I'm looking for a good Tug-O-War partner.
  • Purity 0%
  • Age 3 months
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCAAGAACCTCCTCAACACCCTGACTAAACTAC
C
C
A
A
G
A
A
C
C
T
C
C
T
C
A
A
C
A
C
C
C
T
G
A
C
T
A
A
A
C
T
A
C
Genes: 58KN74LBDGJ

Composition

Labrador
9%
Golder Retriever
9%
Maltese
9%
Pitbull terrier
9%
German Shepard
9%
Husky
9%
Grey Wolf
9%
St. Bernard
9%
Beagle
9%
Boxer
9%
Border Collie
9%

Current Energy

Vitality -16 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador
Tail Golder Retriever
Legs Maltese
Front Legs Pitbull terrier
Head German Shepard
Ears Husky
Snout Grey Wolf
Mouth St. Bernard
Nose Beagle
Eyes Boxer
Color Border Collie