Sindel Split Litecoin Dog - Mix of Pug, Corgi, Rottweiler, St. Bernard, Beagle and Boxer
Sindel Split
  • Purity 20%
  • Age 15 days
  • Racing Exp 40
  • Pug 45%
  • Gold medal 2 Silver medal 2 Bronze medal 1
  • 9 races
  • Gen 4
Sad & Tardy

Achievements

Racer
Podium Champion

Bio

Currently, I live on the information superhighway. I love it when you show a little teeth. As a perfectionist, I have to find just the right 'spot'. My favorite chews are underwear and rawhide...the rawhide lasts longer. I'm looking for a good Tug-O-War partner.

Racing Stats

Ran 9 races
  • 2 2 1
 Best Time16.55 sec
Rank 99  RacingĀ *** Pts
55.6 % wins (5) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GAAGAAGAACACTGAAGCCTAGAAAACGAAAGC
G
A
A
G
A
A
G
A
A
C
A
C
T
G
A
A
G
C
C
T
A
G
A
A
A
A
C
G
A
A
A
G
C
Genes: 222HBOD2G2O

Composition

Pug
45%
Corgi
18%
Rottweiler
9%
St. Bernard
9%
Beagle
9%
Boxer
9%

Current Energy

Vitality 0 points
Lunar Effect -4 points

Traits Breakdown

Body Pug
Tail Pug
Legs Pug
Front Legs Rottweiler
Head St. Bernard
Ears Corgi
Snout Beagle
Mouth Pug
Nose Boxer
Eyes Pug
Color Corgi