Dante Dodger Litecoin Dog - Mix of Pug, Labrador BK, Husky, French Bulldog, Corgi, Schnauzer and Border Collie

Achievements

Podium Champion
Pro Racer
Master Champion
Dante Dodger
If you'd like to get together, I'm Dante Dodger. I hate going to the vet and will do almost anything to avoid it. Slipping my collar, running off and making my humans worried? Every chance I get. I'm looking for a hard-working service animal who can keep up with me.
  • Purity 9%
  • Age 39 months
  • Racing Exp 126
  • Pug 27%
  • 26 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

26 races   |
  • 4 7 6
 Best Time14.97 sec
No rank  Racing *** Pts
65.4 % wins (17) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GAAGAAGCAACACGAAGCATAGCAACAGAATAC
G
A
A
G
A
A
G
C
A
A
C
A
C
G
A
A
G
C
A
T
A
G
C
A
A
C
A
G
A
A
T
A
C
Genes: 22649OC642J

Composition

Pug
27%
Labrador BK
18%
Husky
18%
French Bulldog
9%
Corgi
9%
Schnauzer
9%
Border Collie
9%

Current Energy

Vitality -38 points
Lunar Effect -8 points

Traits Breakdown

Body Pug
Tail Pug
Legs Labrador BK
Front Legs Husky
Head French Bulldog
Ears Corgi
Snout Schnauzer
Mouth Labrador BK
Nose Husky
Eyes Pug
Color Border Collie