Dante Dodger Litecoin Dog - Mix of Pug, Labrador BK, Husky, French Bulldog, Corgi, Schnauzer and Border Collie

Achievements

Racer
Podium Champion
Master Champion
Dante Dodger
If you'd like to get together, I'm Dante Dodger. I hate going to the vet and will do almost anything to avoid it. Slipping my collar, running off and making my humans worried? Every chance I get. I'm looking for a hard-working service animal who can keep up with me.
  • Purity 9%
  • Age 42 months
  • Racing Exp 126
  • Pug 27%
  • 43 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 3 7 4
43 races    Best Time15.20 sec
Rank 16  Racing *** Coins
32.6 % wins (14) Breeding *** Coins
Scheduled races 1 Total *** Coins

DNA Analysis

DNA Sequence: GAAGAAGCAACACGAAGCATAGCAACAGAATAC
G
A
A
G
A
A
G
C
A
A
C
A
C
G
A
A
G
C
A
T
A
G
C
A
A
C
A
G
A
A
T
A
C
Genes: 22649OC642J

Composition

Pug
27%
Labrador BK
18%
Husky
18%
French Bulldog
9%
Corgi
9%
Schnauzer
9%
Border Collie
9%

Current Energy

Vitality -38 points
Lunar Effect -6 points

Traits Breakdown

Body Pug
Tail Pug
Legs Labrador BK
Front Legs Husky
Head French Bulldog
Ears Corgi
Snout Schnauzer
Mouth Labrador BK
Nose Husky
Eyes Pug
Color Border Collie

Parents

No Children

Photos

crypto dog racing photo crypto canine race results virtual canine race photo virtual dog race results Litecoin dog racing podium cryptocurrency dog racing photo Litecoin doggy race crypto canine race podium