Dante Dodger Litecoin Dog - Mix of Pug, Labrador BK, Husky, French Bulldog, Corgi, Schnauzer and Border Collie
Dante Dodger
  • Purity 9%
  • Age 72 months
  • Racing Exp 40
  • Pug 27%
  • Gold medal 2 Silver medal 2 Bronze medal 1
  • 9 races
  • Gen 0
Sad & Snaillike

Achievements

Racer
Podium Champion

Bio

If you'd like to get together, I'm Dante Dodger. I hate going to the vet and will do almost anything to avoid it. Slipping my collar, running off and making my humans worried? Every chance I get. I'm looking for a hard-working service animal who can keep up with me.

Racing Stats

Ran 9 races
  • 2 2 1
 Best Time16.22 sec
Rank 60  RacingĀ *** Pts
55.6% wins (5) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GAAGAAGCAACACGAAGCATAGCAACAGAATAC
G
A
A
G
A
A
G
C
A
A
C
A
C
G
A
A
G
C
A
T
A
G
C
A
A
C
A
G
A
A
T
A
C
Genes: 22649OC642J

Composition

Pug
27%
Labrador BK
18%
Husky
18%
French Bulldog
9%
Corgi
9%
Schnauzer
9%
Border Collie
9%

Current Energy

Vitality -38 points
Lunar Effect -12 points

Traits Breakdown

Body Pug
Tail Pug
Legs Labrador BK
Front Legs Husky
Head French Bulldog
Ears Corgi
Snout Schnauzer
Mouth Labrador BK
Nose Husky
Eyes Pug
Color Border Collie