Sweet Tooth Split Crypto Dog - Mix of Husky, Yorkshire Terrier, Golder Retriever, Boxer, Poodle, Labrador BK and Beagle

Achievements

Racer
Podium Champion
Sweet Tooth Split
I feel totally safe lying naked on a rug in front of a digital fire, surrounded by firewalls. I never met a crotch or a butt I didn't like, but I'm just friendly that way. I usually spend my days protecting my yard from those pesky squirrels. I don't know what it is, but I know they're up to no good...
  • Purity 11%
  • Age 18 months
  • Racing Exp 52
  • Husky 18%
  • 24 races
  • Gen 12
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

24 races   |
  • 1 1 3
 Best Time15.92 sec
No rank  Racing *** Pts
20.8 % wins (5) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: ACATTATTAAGAAGAGACAACGCACTAAACACA
A
C
A
T
T
A
T
T
A
A
G
A
A
G
A
G
A
C
A
A
C
G
C
A
C
T
A
A
A
C
A
C
A
Genes: 4FF88IG6DG4

Composition

Husky
18%
Yorkshire Terrier
18%
Golder Retriever
18%
Boxer
18%
Poodle
9%
Labrador BK
9%
Beagle
9%

Current Energy

Vitality -38 points
Lunar Effect +10 points

Traits Breakdown

Body Husky
Tail Yorkshire Terrier
Legs Yorkshire Terrier
Front Legs Golder Retriever
Head Golder Retriever
Ears Poodle
Snout Boxer
Mouth Labrador BK
Nose Beagle
Eyes Boxer
Color Husky