Oracle Ozzie Crypto Game Dog - Mix of Husky, Yorkshire Terrier, Boxer, Grey Wolf, Border Collie, Poodle, Labrador BK and Beagle
Oracle Ozzie
  • Purity 8%
  • Age 17 months
  • Racing Exp 36
  • Husky 18%
  • Gold medal 2 Silver medal 1 Bronze medal 1
  • 11 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer
Podium Champion

Bio

I am a guard dog for the data warehouse. Dragging my butt on the carpet feels so good. Of course, I'm micro-chipped. I'm up on all the latest tech gadgets. I hate never catching that damn rabbit in my dreams. I want to find a mate who enjoys dog parks as much as I do.

Racing Stats

Ran 11 races
  • 2 1 1
 Best Time16.05 sec
No rank  RacingĀ *** Pts
36.4 % wins (4) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: ACATTATTACCCTACGACAACGCACTAAACACA
A
C
A
T
T
A
T
T
A
C
C
C
T
A
C
G
A
C
A
A
C
G
C
A
C
T
A
A
A
C
A
C
A
Genes: 4FFLJIG6DG4

Composition

Husky
18%
Yorkshire Terrier
18%
Boxer
18%
Grey Wolf
9%
Border Collie
9%
Poodle
9%
Labrador BK
9%
Beagle
9%

Current Energy

Vitality -10 points
Lunar Effect -2 points

Traits Breakdown

Body Husky
Tail Yorkshire Terrier
Legs Yorkshire Terrier
Front Legs Grey Wolf
Head Border Collie
Ears Poodle
Snout Boxer
Mouth Labrador BK
Nose Beagle
Eyes Boxer
Color Husky