Sunday Sindel Crypto Dog - Mix of Pug, Pitbull terrier, Poodle, Shiba Inu, Border Collie, Rottweiler and Grey Wolf
Sunday Sindel
  • Purity 18%
  • Age 15 months
  • Racing Exp 2
  • Pug 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 2 races
  • Gen 5
Depressed & Snaillike

Achievements

Racer

Bio

I don't mind sharing my bed with someone I just met, if we can cuddle. I absolutely love long walks when I can stop and smell the bushes. I'm totally against baths! They are the worst! I am on a mission to sniff all the butts in the world. ALL the butts.

Racing Stats

Ran 2 races
  • 0 0 0
 Best Time16.62 sec
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TCCGAAGAAGACGTATACGAACACCCCGAAGAA
T
C
C
G
A
A
G
A
A
G
A
C
G
T
A
T
A
C
G
A
A
C
A
C
C
C
C
G
A
A
G
A
A
Genes: N22IEJ2HL22

Composition

Pug
45%
Pitbull terrier
9%
Poodle
9%
Shiba Inu
9%
Border Collie
9%
Rottweiler
9%
Grey Wolf
9%

Current Energy

Vitality -53 points
Lunar Effect 0 points

Traits Breakdown

Body Pitbull terrier
Tail Pug
Legs Pug
Front Legs Poodle
Head Shiba Inu
Ears Border Collie
Snout Pug
Mouth Rottweiler
Nose Grey Wolf
Eyes Pug
Color Pug

Parents

No Children

Photos

Gift