Sunday Sindel Crypto Dog - Mix of Pug, Pitbull terrier, Poodle, Shiba Inu, Border Collie, Rottweiler and Grey Wolf

Achievements

Racer
Sunday Sindel
I don't mind sharing my bed with someone I just met, if we can cuddle. I absolutely love long walks when I can stop and smell the bushes. I'm totally against baths! They are the worst! I am on a mission to sniff all the butts in the world. ALL the butts.
  • Purity 18%
  • Age 18 months
  • Racing Exp 35
  • Pug 45%
  • 16 races
  • Gen 5
Share it to make him Happy!
Happy & Quick
Energy: ▂▃▅▆▇

Racing Stats

16 races   |
  • 1 2 0
 Best Time15.35 sec
No rank  Racing *** Pts
18.8 % wins (3) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCCGAAGAAGACGTATACGAACACCCCGAAGAA
T
C
C
G
A
A
G
A
A
G
A
C
G
T
A
T
A
C
G
A
A
C
A
C
C
C
C
G
A
A
G
A
A
Genes: N22IEJ2HL22

Composition

Pug
45%
Pitbull terrier
9%
Poodle
9%
Shiba Inu
9%
Border Collie
9%
Rottweiler
9%
Grey Wolf
9%

Current Energy

Vitality -53 points
Lunar Effect 0 points

Traits Breakdown

Body Pitbull terrier
Tail Pug
Legs Pug
Front Legs Poodle
Head Shiba Inu
Ears Border Collie
Snout Pug
Mouth Rottweiler
Nose Grey Wolf
Eyes Pug
Color Pug