Cali Clover Bitcoin Dog - Mix of Husky, Labrador, Grey Wolf, St. Bernard, Corgi, Schnauzer, Poodle, Shiba Inu, Golder Retriever, Pug and Beagle
Cali Clover
  • Purity 0%
  • Age 17 months
  • Racing Exp 35
  • Mixed-breed
  • Gold medal 2 Silver medal 2 Bronze medal 0
  • 9 races
  • Gen 0
Neutral & Casual

Achievements

Racer

Bio

I love digging. No particular reason, it just satisfies me to make a huge, muddy mess wherever I go. I believe running along the beach to catch a stick can be nearly orgasmic. I hate bubble baths; mud puddles are more my style. I cry whenever I hear an ambulance siren!

Racing Stats

Ran 9 races
  • 2 2 0
 Best Time14.72 sec
Rank 25  RacingĀ *** Pts
44.4 % wins (4) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: ACACCACCCTGAAGCATAGACGTAAGAGAACTA
A
C
A
C
C
A
C
C
C
T
G
A
A
G
C
A
T
A
G
A
C
G
T
A
A
G
A
G
A
A
C
T
A
Genes: 45LBOCIE82D

Composition

Husky
9%
Labrador
9%
Grey Wolf
9%
St. Bernard
9%
Corgi
9%
Schnauzer
9%
Poodle
9%
Shiba Inu
9%
Golder Retriever
9%
Pug
9%
Beagle
9%

Current Energy

Vitality -25 points
Lunar Effect -12 points

Traits Breakdown

Body Husky
Tail Labrador
Legs Grey Wolf
Front Legs St. Bernard
Head Corgi
Ears Schnauzer
Snout Poodle
Mouth Shiba Inu
Nose Golder Retriever
Eyes Pug
Color Beagle