Kipling Khloe Litecoin Dog - Mix of Husky, Boxer, St. Bernard, German Shepard and French Bulldog

Achievements

Racer
Kipling Khloe
The cloud's my neighborhood. I'm always up for a nice long walk around the neighborhood. I'll be honest...Napping is my favorite so we gotta go slow. I hate being left alone all day. I just want to share a ball with someone, if you know what I mean...
  • Purity 32%
  • Age 22 months
  • Racing Exp 8
  • Husky 55%
  • 2 races
  • Gen 17
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 0 1 0
 Best Time15.55 sec
No rank  Racing *** Coins
50.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAACAAACAACTGAACATCACGAACAACAACA
A
C
A
A
C
A
A
A
C
A
A
C
T
G
A
A
C
A
T
C
A
C
G
A
A
C
A
A
C
A
A
C
A
Genes: 44GGB479444

Composition

Husky
55%
Boxer
18%
St. Bernard
9%
German Shepard
9%
French Bulldog
9%

Current Energy

Vitality -30 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail Husky
Legs Boxer
Front Legs Boxer
Head St. Bernard
Ears Husky
Snout German Shepard
Mouth French Bulldog
Nose Husky
Eyes Husky
Color Husky