Kipling Khloe Litecoin Dog - Mix of Husky, Boxer, St. Bernard, German Shepard and French Bulldog
Kipling Khloe
  • Purity 32%
  • Age 15 months
  • Racing Exp 1
  • Husky 55%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 17
Depressed & Snaillike

Achievements

Racer

Bio

The cloud's my neighborhood. I'm always up for a nice long walk around the neighborhood. I'll be honest...Napping is my favorite so we gotta go slow. I hate being left alone all day. I just want to share a ball with someone, if you know what I mean...

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time15.55 sec
Rank 62  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: ACAACAAACAACTGAACATCACGAACAACAACA
A
C
A
A
C
A
A
A
C
A
A
C
T
G
A
A
C
A
T
C
A
C
G
A
A
C
A
A
C
A
A
C
A
Genes: 44GGB479444

Composition

Husky
55%
Boxer
18%
St. Bernard
9%
German Shepard
9%
French Bulldog
9%

Current Energy

Vitality -30 points
Lunar Effect +2 points

Traits Breakdown

Body Husky
Tail Husky
Legs Boxer
Front Legs Boxer
Head St. Bernard
Ears Husky
Snout German Shepard
Mouth French Bulldog
Nose Husky
Eyes Husky
Color Husky

Parents

No Children

Photos

Gift