Kipling Khloe Litecoin Dog - Mix of Husky, Boxer, St. Bernard, German Shepard and French Bulldog

Achievements

Racer
Podium Champion
Kipling Khloe
The cloud's my neighborhood. I'm always up for a nice long walk around the neighborhood. I'll be honest...Napping is my favorite so we gotta go slow. I hate being left alone all day. I just want to share a ball with someone, if you know what I mean...
  • Purity 32%
  • Age 18 months
  • Racing Exp 60
  • Husky 55%
  • 21 races
  • Gen 17
Share it to make him Happy!
Neutral & Casual
Energy: ▂▃▅▆▇

Racing Stats

21 races   |
  • 1 2 4
 Best Time15.12 sec
Rank 14  Racing *** Pts
33.3 % wins (7) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACAACAAACAACTGAACATCACGAACAACAACA
A
C
A
A
C
A
A
A
C
A
A
C
T
G
A
A
C
A
T
C
A
C
G
A
A
C
A
A
C
A
A
C
A
Genes: 44GGB479444

Composition

Husky
55%
Boxer
18%
St. Bernard
9%
German Shepard
9%
French Bulldog
9%

Current Energy

Vitality -30 points
Lunar Effect +2 points

Traits Breakdown

Body Husky
Tail Husky
Legs Boxer
Front Legs Boxer
Head St. Bernard
Ears Husky
Snout German Shepard
Mouth French Bulldog
Nose Husky
Eyes Husky
Color Husky