Jiminy Jak Crypto Dog - Mix of Boxer, Golder Retriever, Labrador, Rottweiler, Yorkshire Terrier, German Shepard, French Bulldog, Beagle, Husky and Dachshund

Achievements

Podium Champion
Pro Racer
Jiminy Jak
Good day to you! I'm Jiminy Jak! Someday I'm gonna breakout from inside this server. I love the smell of freshly cut grass. I wish my human would stop putting clothes on me. Don't try to cover my flawless fur! Removing excess stuffing from pillows is my favorite hobby.
  • Purity 1%
  • Age 39 months
  • Racing Exp 75
  • Boxer 18%
  • 21 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

21 races   |
  • 2 5 2
 Best Time15.77 sec
No rank  Racing *** Pts
42.9 % wins (9) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGACCAAACCACAACTTATCACGACTAACAGGA
A
G
A
C
C
A
A
A
C
C
A
C
A
A
C
T
T
A
T
C
A
C
G
A
C
T
A
A
C
A
G
G
A
Genes: 85GHGF79D4A

Composition

Boxer
18%
Golder Retriever
9%
Labrador
9%
Rottweiler
9%
Yorkshire Terrier
9%
German Shepard
9%
French Bulldog
9%
Beagle
9%
Husky
9%
Dachshund
9%

Current Energy

Vitality -32 points
Lunar Effect -12 points

Traits Breakdown

Body Golder Retriever
Tail Labrador
Legs Boxer
Front Legs Rottweiler
Head Boxer
Ears Yorkshire Terrier
Snout German Shepard
Mouth French Bulldog
Nose Beagle
Eyes Husky
Color Dachshund