Jiminy Jak Crypto Dog - Mix of Boxer, Golder Retriever, Labrador, Rottweiler, Yorkshire Terrier, German Shepard, French Bulldog, Beagle, Husky and Dachshund

Achievements

Racer
Jiminy Jak
Good day to you! I'm Jiminy Jak! Someday I'm gonna breakout from inside this server. I love the smell of freshly cut grass. I wish my human would stop putting clothes on me. Don't try to cover my flawless fur! Removing excess stuffing from pillows is my favorite hobby.
  • Purity 1%
  • Age 42 months
  • Racing Exp 2
  • Boxer 18%
  • 2 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
2 races    Best Time16.40 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGACCAAACCACAACTTATCACGACTAACAGGA
A
G
A
C
C
A
A
A
C
C
A
C
A
A
C
T
T
A
T
C
A
C
G
A
C
T
A
A
C
A
G
G
A
Genes: 85GHGF79D4A

Composition

Boxer
18%
Golder Retriever
9%
Labrador
9%
Rottweiler
9%
Yorkshire Terrier
9%
German Shepard
9%
French Bulldog
9%
Beagle
9%
Husky
9%
Dachshund
9%

Current Energy

Vitality -32 points
Lunar Effect -12 points

Traits Breakdown

Body Golder Retriever
Tail Labrador
Legs Boxer
Front Legs Rottweiler
Head Boxer
Ears Yorkshire Terrier
Snout German Shepard
Mouth French Bulldog
Nose Beagle
Eyes Husky
Color Dachshund