Gabe Giselle Bitcoin Dog - Mix of Pug, Grey Wolf, Border Collie, Maltese, Labrador, Boxer, Yorkshire Terrier, German Shepard, Dachshund and Beagle

Achievements

Racer
Gabe Giselle
I'm a little said right now because my friend just got hit trying to dodge heavy web traffic. I believe running along the beach to catch a stick can be nearly orgasmic. I love it when you show a little teeth. After introductory sniffing, I like some licking.
  • Purity 3%
  • Age 21 months
  • Racing Exp 6
  • Pug 18%
  • 1 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 1
1 races    Best Time17.35 sec
No rank  Racing *** Coins
100.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCTACACCCCAAACTTATCAGGACTAGAAGAA
C
C
C
T
A
C
A
C
C
C
C
A
A
A
C
T
T
A
T
C
A
G
G
A
C
T
A
G
A
A
G
A
A
Genes: LJK5GF7AD22

Composition

Pug
18%
Grey Wolf
9%
Border Collie
9%
Maltese
9%
Labrador
9%
Boxer
9%
Yorkshire Terrier
9%
German Shepard
9%
Dachshund
9%
Beagle
9%

Current Energy

Vitality -30 points
Lunar Effect -2 points

Traits Breakdown

Body Grey Wolf
Tail Border Collie
Legs Maltese
Front Legs Labrador
Head Boxer
Ears Yorkshire Terrier
Snout German Shepard
Mouth Dachshund
Nose Beagle
Eyes Pug
Color Pug