Gabe Giselle Bitcoin Dog - Mix of Pug, Grey Wolf, Border Collie, Maltese, Labrador, Boxer, Yorkshire Terrier, German Shepard, Dachshund and Beagle
Gabe Giselle
  • Purity 3%
  • Age 17 months
  • Racing Exp 30
  • Pug 18%
  • Gold medal 1 Silver medal 1 Bronze medal 2
  • 7 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer
Podium Champion

Bio

I'm a little said right now because my friend just got hit trying to dodge heavy web traffic. I believe running along the beach to catch a stick can be nearly orgasmic. I love it when you show a little teeth. After introductory sniffing, I like some licking.

Racing Stats

Ran 7 races
  • 1 1 2
 Best Time16.97 sec
No rank  RacingĀ *** Pts
57.1 % wins (4) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCCTACACCCCAAACTTATCAGGACTAGAAGAA
C
C
C
T
A
C
A
C
C
C
C
A
A
A
C
T
T
A
T
C
A
G
G
A
C
T
A
G
A
A
G
A
A
Genes: LJK5GF7AD22

Composition

Pug
18%
Grey Wolf
9%
Border Collie
9%
Maltese
9%
Labrador
9%
Boxer
9%
Yorkshire Terrier
9%
German Shepard
9%
Dachshund
9%
Beagle
9%

Current Energy

Vitality -30 points
Lunar Effect -8 points

Traits Breakdown

Body Grey Wolf
Tail Border Collie
Legs Maltese
Front Legs Labrador
Head Boxer
Ears Yorkshire Terrier
Snout German Shepard
Mouth Dachshund
Nose Beagle
Eyes Pug
Color Pug

Parents

No Children

Photos

virtual canine race photo virtual canine racing crypto canine racing online dog racing
Gift