Puddles Poochie Digital Cryptocurrency Dog - Mix of Pug, Grey Wolf, Border Collie, Maltese, Labrador, Labrador BK, Golder Retriever, Boxer, Dachshund and French Bulldog
Puddles Poochie
  • Purity 3%
  • Age 17 months
  • Racing Exp 37
  • Pug 18%
  • Gold medal 1 Silver medal 2 Bronze medal 2
  • 8 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer
Podium Champion

Bio

Wassup? Yo, call me Puddles Poochie. I hate not being allowed to hunt treasure in the garbage. It smells so good! Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays. I like to play fetch with a tennis ball. If I can't reach it to clean it myself, it doesn't need cleaning!

Racing Stats

Ran 8 races
  • 1 2 2
 Best Time16.45 sec
Rank 85  RacingĀ *** Pts
62.5 % wins (5) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCCTACACCCCAGCAAGAAACGGACGAGAAGAA
C
C
C
T
A
C
A
C
C
C
C
A
G
C
A
A
G
A
A
A
C
G
G
A
C
G
A
G
A
A
G
A
A
Genes: LJK568GA922

Composition

Pug
18%
Grey Wolf
9%
Border Collie
9%
Maltese
9%
Labrador
9%
Labrador BK
9%
Golder Retriever
9%
Boxer
9%
Dachshund
9%
French Bulldog
9%

Current Energy

Vitality -30 points
Lunar Effect -8 points

Traits Breakdown

Body Grey Wolf
Tail Border Collie
Legs Maltese
Front Legs Labrador
Head Labrador BK
Ears Golder Retriever
Snout Boxer
Mouth Dachshund
Nose French Bulldog
Eyes Pug
Color Pug