Puddles Poochie Digital Cryptocurrency Dog - Mix of Pug, Grey Wolf, Border Collie, Maltese, Labrador, Labrador BK, Golder Retriever, Boxer, Dachshund and French Bulldog

Achievements

Racer
Puddles Poochie
Wassup? Yo, call me Puddles Poochie. I hate not being allowed to hunt treasure in the garbage. It smells so good! Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays. I like to play fetch with a tennis ball. If I can't reach it to clean it myself, it doesn't need cleaning!
  • Purity 3%
  • Age 21 months
  • Racing Exp 18
  • Pug 18%
  • 7 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 1 1
7 races    Best Time15.98 sec
Rank 58  Racing *** Coins
28.6 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCTACACCCCAGCAAGAAACGGACGAGAAGAA
C
C
C
T
A
C
A
C
C
C
C
A
G
C
A
A
G
A
A
A
C
G
G
A
C
G
A
G
A
A
G
A
A
Genes: LJK568GA922

Composition

Pug
18%
Grey Wolf
9%
Border Collie
9%
Maltese
9%
Labrador
9%
Labrador BK
9%
Golder Retriever
9%
Boxer
9%
Dachshund
9%
French Bulldog
9%

Current Energy

Vitality -30 points
Lunar Effect -2 points

Traits Breakdown

Body Grey Wolf
Tail Border Collie
Legs Maltese
Front Legs Labrador
Head Labrador BK
Ears Golder Retriever
Snout Boxer
Mouth Dachshund
Nose French Bulldog
Eyes Pug
Color Pug