Donkey Kong Dharma Cryptocurrency Game Dog - Mix of Husky, Golder Retriever and St. Bernard

Achievements

None
Donkey Kong Dharma
Hey dawg! I'm Donkey Kong Dharma. Oh, go ahead. Pet me. I know you want to. I enjoy crunchy kibble and drinking from toilets. The absolute best time of day is dinner time! You know the worst? Watching my humans 'get it on' and I have to lick myself.
  • Purity 67%
  • Age 42 months
  • Racing Exp 0
  • Husky 82%
  • 0 races
  • Gen 15
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAACAACAAGATGAACAACAACAACAACAACA
A
C
A
A
C
A
A
C
A
A
G
A
T
G
A
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
Genes: 4448B444444

Composition

Husky
82%
Golder Retriever
9%
St. Bernard
9%

Current Energy

Vitality -6 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail Husky
Legs Husky
Front Legs Golder Retriever
Head St. Bernard
Ears Husky
Snout Husky
Mouth Husky
Nose Husky
Eyes Husky
Color Husky