Marie Max Payne Litecoin Game Dog - Mix of Husky, Golder Retriever and St. Bernard

Achievements

None
Marie Max Payne
My favorite pastime is playing tug-of-war with my human's underwear. Are you into garbage cans? I am. I hate bubble baths; mud puddles are more my style. I'll lick anything.
  • Purity 67%
  • Age 41 months
  • Racing Exp 0
  • Husky 82%
  • 0 races
  • Gen 14
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAACAACAAGATGAACAACAACAACAACAACA
A
C
A
A
C
A
A
C
A
A
G
A
T
G
A
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
Genes: 4448B444444

Composition

Husky
82%
Golder Retriever
9%
St. Bernard
9%

Current Energy

Vitality -6 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail Husky
Legs Husky
Front Legs Golder Retriever
Head St. Bernard
Ears Husky
Snout Husky
Mouth Husky
Nose Husky
Eyes Husky
Color Husky