Alvin Axel Cryptocurrency Dog - Mix of Husky, Labrador, Golder Retriever and St. Bernard

Achievements

Racer
Alvin Axel
They call me Alvin Axel. What's your name? I hate being left alone all day. My favorite place in the world is the dog park. So many smells! I've always had a crush on Lassie. I am looking for my best friend, lover, and equal partner to share my food bowl.
  • Purity 52%
  • Age 38 months
  • Racing Exp 8
  • Husky 73%
  • 1 races
  • Gen 11
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 1 0 0
 Best Time16.07 sec
No rank  Racing *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCAACAACAAGATGAACAACAACAACAACAACA
C
C
A
A
C
A
A
C
A
A
G
A
T
G
A
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
Genes: 5448B444444

Composition

Husky
73%
Labrador
9%
Golder Retriever
9%
St. Bernard
9%

Current Energy

Vitality -4 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador
Tail Husky
Legs Husky
Front Legs Golder Retriever
Head St. Bernard
Ears Husky
Snout Husky
Mouth Husky
Nose Husky
Eyes Husky
Color Husky