Bond Bunky Bitcoin Game Dog - Mix of Husky, Labrador, French Bulldog and St. Bernard

Achievements

Racer
Bond Bunky
I love cuddling up, doggy-style after a romantic evening. I'll be honest...Napping is my favorite so we gotta go slow. I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary! If I can't reach it to clean it myself, it doesn't need cleaning!
  • Purity 52%
  • Age 38 months
  • Racing Exp 1
  • Husky 73%
  • 1 races
  • Gen 12
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 0
 Best Time16.28 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCAACAACACGATGAACAACAACAACAACAACA
C
C
A
A
C
A
A
C
A
C
G
A
T
G
A
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
Genes: 5449B444444

Composition

Husky
73%
Labrador
9%
French Bulldog
9%
St. Bernard
9%

Current Energy

Vitality -12 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador
Tail Husky
Legs Husky
Front Legs French Bulldog
Head St. Bernard
Ears Husky
Snout Husky
Mouth Husky
Nose Husky
Eyes Husky
Color Husky